DNA Base Data Hiding Algorithm

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

DNA Base Data Hiding Algorithm
Mohammad Reza Abbasy, Pourya Nikfard, Ali Ordi,
and Mohammad Reza Najaf Torkaman
Advanced Informatics School (AIS), International Campus, Universiti Teknologi
Malaysia (UTM), Kuala Lumpur.
{ramohammad2, npourya2, oali2, rntmohammad2}@live.utm.my

ABSTRACT
Proposing an algorithm by using software point
of view for the purpose of implementing data
hiding based on DNA sequences to increase the
complexity is the main target of this paper. The
implementation of algorithm is applicable
because of some interesting characteristics of
DNA sequences. Both of DNA’s features and
Binary
Coding
Technology
beside
Complementary Pairing Rules are explained
through the paper. Since, both of a secret
message (M) and DNA reference sequence is
needed. Data hiding is started by applying three
different and separate steps to prepare M´´´. The
receiver will apply the process of identifying and
extracting the original message (M) which had
been hidden in DNA reference sequence. As the
security of the algorithm is crucial part, it will
appear in security issue’s section.

KEYWORDS
DNA sequence; data hiding; DNA
base pairing rules; complementary
pairing rules; DNA binary coding.

1

INTRODUCTION

In order to protect data through the
unsecure networks like the Internet,
using various types of data protection is
necessary. One of the famous ways to
protect data through the Internet is data
hiding. Because of the increasing
number of Internet users, utilizing data
hiding or Steganographic techniques is
inevitable. Eliminating the role of the

intruder and authorizing the receiver, are
eventual goals of these techniques.
Thus, the role of data hiding has
become more eminent nowadays. Before
employing biological properties of DNA
sequences, usually embedding a secret
message into the host images was the
traditional way of data hiding [1, 2, 3, 4,
and 5].

Unfortunately, this had some liabilities.
The most important ones was the
detection of the distortions of the image
when the host image changed to some
degrees. This spot was the best spot to
start the wholly detection of the secret
message through the image. With advent
of biological aspects of DNA sequences
to the computing areas, new data hiding
methods have been proposed by
researchers, based on DNA sequences
[6, 7, 8, 9, and 10]. The key portion of
their work is, utilizing biological
characteristics of DNA sequences.

In order to convert binary data into
amino acids as a DNA sequence, the
base pairing rules must be used.
Synthesizing nucleotides
in
real
environment (biology) is done in
constant rules:

183

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)


Purine Adenine
(A)
always
pairs
with
the pyrimidine Thymine (T)

Pyrimidine Cytosine (C)
always
pairs
with
the
purine Guanine (G)

Always, those rules are done naturally
because the opportunities to synthesize
hydrogen bonds between A and T (two
bonds), and also between C and G (three
bonds) is different, basically (hydrogen
bonds have been shown with dotted lines
in Fig1). These concepts are named
Watson-Crick base pairing rules when
they discovered DNA’s fundamental
structure as a Noble prize [13].

Figure 1.
naturally

Synthesizing

basic

nucleotides

A way to increase the complexity is
complementary
pair
rule.
Complementary pair rule is a unique
equivalent pair which is assigned to
every nucleotides base pair. As an
example, complementary rule is applied
on strand in below [16]:

Complementary rule: ((AC) (CG) (GT)
(TA))
DNA strand: AATGC
Applying complementary rule on DNA
strand: CCATG
Increasing the complexity is the main
purpose of using those rules, in this
paper. It means that, finding the original
message by intruder needs extra
calculations because there are four basic
alphabets therefore four likelihood of
complementary rule for every DNA
sequences. So, the final number of
possible those rules are 4×3×2×1=24.
On the other hand, the possibility to
happen a correct guess is . Extra
information and findings for some basic
definitions can be obtained in molecular
biology reference books [11, 12, and
13].
2

In binary computing area, it is possible
to change the natural rules by own
decision. For example, in biology A is
synthesized to T while we can assume A
to C or A to G, and so on, as we prefer.
Increasing the complexity of the
algorithm is the main purpose of the
changing the rules. In this paper, the
authors consider A=00, T=01, C=10, and
G=11 to convert binary message to DNA
sequences.

RELATED WORKS

For the purpose of clarifying the
algorithm in current paper, introducing
some backgrounds of the knowledge is
necessary [8, 11, 12, and 13]. The most
important part of each DNA base data
hiding algorithm is, manipulating four
letters which has been called as
nucleotides in biology. The letters are A,
C, G, and T. Any composition from
them will make a sequence. For instance,
two DNA sequences have been appeared
in [16]. They mentioned sequences from

184

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

European
Bioinformatics
Institute
(which is known as EBI Database) [15]
for the purpose of extracting DNA
sequences of Litmus and Balsaminaceae.
So, Litmus with 154 nucleotides and
Balsaminaceae with 2283 are shown in
below, respectively:

Litmus:
“ATCGAATTCGCGCTGAGTCACAA
TTCGCGCTGAGTCACAATTCGCGC
TGAGTCACAATTGTGACTCAGCCG
CGAATTCCTGCAGCCCCGAATTCC
GCATTGCAGAGATAATTGTATTTA
AGTGCCTGCTCGATACAATAAACG
CCATTTGACC”.
Balsaminaceae:
“TTTTTATTATTTTTTTTCATTTTTT
TCTCAGTTTTTAGCACATATCATT
ACATTTTATTTTTTCATTACTTCTA
TCATTCTATCTATAAAATCGATTA
TTTTTATCACTTATTTTTCTAATTT
CCATATTTCATCTAATGATTATATT
ACATTAAAGAAATCG”.
Even though data can be shown by DNA
nucleotides, but representing to binary
was emerged in 1999 by Rauhe and et al.
[17]. They represented numbers by using
binary DNA sequences in figure 1. The
creativity of their work was in how they
could separate binary sequences from
each other.

All binary sequences are illustrated in
form of s{0|1}e. An arbitrary DNA bits
has been concatenated between two
terminations, s and e, as start and end,
respectively. Annealing and ligation are
the way of concatenating DNA bits
between s and e. Both of terminations
and DNA bits have been made by
annealing
complementary
oligonucleotides. In order to concatenate
on both sides, having sticky ends (A, Ā,
X, Ȳ) are necessary. The sticky end
A(Ā) acts as a variable for correct
concatenation of bits and terminations.
For subsequent cloning, the sticky ends
X and Ȳ should be used.

In 2000 Leier and et al. [8] brought a
robust technique by utilizing a special
key strand. They called it, primer.
Primer has key role to decrypt a coded
strand. Using a public DNA strand was
utilized as a reference sequence in their
DNA based encryption technique. In this
scheme, the receiver must also be
informed about the reference sequence.
Namely, the receiver will receive a
selected primer and an encrypted strand.
The intruder is not able to decrypt the
binary data without knowing about both
of primer and reference strand, certainly.
A primer is a complementary subset
from a sort of DNA strand. Normally,
the primer is called a short substring. For
example, assume S is a DNA strand:

S=
“ATGCTTAGTTCCATCGGAGACTAATGGCCTA”

Figure 2. Assembly of DNA binary strands [8].

and “two primers ATCAA and
GATTAC”. So “ATCAA and GATTAC
are complementary substring of TAGTT
and
CTAATG”,
correspondingly.
Definitely, a complementary rule is
needed to handle the manipulations,
correctly. For this reason, they defined a
185

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

complementary rule which is A-T, T-A,
C-G, and finally G-C. Accomplishing
those states in biology is done by a series
of chemical mechanisms to combine
primers with a DNA strand. Indicating
the right position of the primers also is
shown by a fluorescent chemical
substance. When hybridization occurs
among primers and substrings of the
reference DNA reference sequence, it
will become bright, obviously. Except
bright places, remaining are dim
sections. The exact message of bright
portion is binary data ‘1’ and naturally, a
dim portion is referred to the binary data
‘0’. So, according to the above, the
proper output of the hybridization is:

Therefore, the final secret message in
form of binary is “01010”. If the sender
prefers to complicate that proposed
technique, it can send one part of
primers to the legitimate receiver. For
the purpose of recovering primers, the
receiver must apply PCR. PCR is
another chemical scheme which has
been known as Polymerase Chain
Reaction, scientifically. It can recover
primers correctly [16].

Considering a certain substring from
DNA sequence as a character was
proposed by Peterson in 2001 [9]. By
substituting three successive nucleotides
as a character, he could hide data in

DNA sequence, appropriately. For
instance, ‘A’=GGC, ‘B’=ATG, and so
on. So, for this scheme we face to 64
symbols that can be possibly encrypted.

The main liability of this method is the
frequency for both of ‘E’ and ‘I’ in an
English message. Because of those
holes, an intruder can apply a
cryptanalysis
technique
base
on
frequencies of the most repetitive letters
in English and subsequently extracts the
secret message, simply.

The next scheme in 2002 [18] needs
some backgrounds before explaining. An
arrangement of nucleotides determines a
protein. The responsibility of the
proteins is almost every activity in cells.
Transcription is the process by which
RNA is created, an intermediary copy of
the instruction contained in DNA.
Naturally, RNA has four bases. They are
adenine (A), cytosine (C), uracil (U) and
guanine (G). The RNA copy is related to
mRNA (abstract of messenger RNA) by
throwing away the coming among
sequences of RNA. On mRNA, each
codon has three nucleotides for the
purpose of representing which amino
acid must be assigned in the next
position. All different amino acids have
been listed in Table 1. They are: Phe,
Leu, Ile, Val, Ser, Pro, Thr, Ala, Tyr,
His, Gln, Asn, Lys, Asp, Glu, Cys, Trp,
Arg, Met and Gly. Each codon binds a
set of three nucleotides into an anticodon
which is called tRNA molecule (transfer
RNA). The responsibility of the tRNA
is, translating nucleic acid into protein.
Totally, there are forty separate tRNA
molecules which each one has a binding
for one of amino acids, as represented in
Table 1.
186

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

Apposite tRNA is bound to codon on the
mRNA. When the STOP codon was
seen, the translation is completed, and
then a protein is released. Because of the
codon redundancy, Shimanovsky et al.
[18] utilized from that feature to hide
data in mRNA. In general, each mRNA
codon has been composed of three
nucleotides. The likely nucleotides are:
‘U’, ‘C’, ‘A’, and ‘G’. Therefore, there
are
many
different
probable
combinations to form each mRNA
codon, whereas in Table 1, there are
only twenty different amino acids. It is
because of some codons might be
mapped to the same amino acids. For
instance, the codons ‘UUA’, ‘CUU’,
‘CUA’ and ‘UUG’ are mapped to the
same amino acid Leu.

Feasibility of embedding information in
the mRNA codon is because of the
redundancy. For example, if the codon
must be encrypted with ‘UUA’, while
the secret message if four, it is possible
to use the codon ‘UUG’ in order to
replace the original. It is feasible
because ‘UUG’ is the fourth codon of all
the codons whose mapping amino acid is
Leu. Even though previous replacement
does not have any effect on the results of
transcription, but it modifies the
nucleotides of the original sequence, that
might probably trigger unidentified
consequences.

Although the previous beginning
schemes utilize distinct biological
features for hiding data in DNA
sequences, they are not cost-effective
and efficient to employ. In this paper, we
apply a scheme to hide data in DNA
strands based on a software point of
view to improve them.

3

PROPOSED METHOD

This section is divided into two
phases. The first one is, embedding and
the second one is, extracting the original
message. At the end of the method, a
snapshot of the project will appear.

3.1 Phase1:
Message

Embedding

Secret

In order to explain embedding phase,
separating the phases into some
successive and vivid sub-phases, is the
best way of proposing current method.
In below, sub-phases have been shown,
respectively.

M= Message
Convert Binary to DNA Nucleotides

M´=DNA Sequence
from M
Applying Complementary Rules on M´

M´´= New Form of M´
Finding Index of each Couple of Nucleotides in
DNA Reference Sequence

M´´´=Secret Message

Figure 3. Phase 1: embedding secret message

Obviously, there is an original
message M which the sender decides to
send via a network to another client who
is called receiver. So, there are three
sub-phases to provide the final form of
M which is M´´´ and send it to receiver.
The first sub-phase is, converting by
DNA base pairing rules. The product is
M´. M´ contains nucleotides sequences.
By applying DNA base pairing rules, the
187

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

message can convert from binary to
DNA sequence. Not only DNA base
pairing helps to encrypt the message
from binary to DNA sequence but also it
is applied to decrypt the secret message
to original one, truly.
The next (second) sub-phase is,
applying
complementary
rules.
Increasing the complexity is the real and
exact purpose of this step. By applying
the complementary rules, the new form
of the M´ which is M´´ emerges. Now,
M´´ is appeared. As mentioned before,
both of sender and receiver have a DNA
reference sequence from a large number
of possibilities base on EBI [14] or
NCBI [15] database. It means that, they
have selected the same DNA reference
sequence, exactly. The exact role of the
third sub-phase is, extracting the index
of each couple nucleotides in DNA
reference sequence, numerically. When
all the indexes have been extracted, M´´´
has been made, properly. M´´´ is
precisely the secret message with some
changes through the embedding phase.
Now, sender can send the message
(M´´´) to receiver.
Clarification of the current phase is
continued by demonstrating an example,
step by step. In this example, assume
original message M=100111000011
should be sent to the receiver.
DNA Reference Sequence:
AT1CG2AA3TT4CG5CG6CT7GA8GT9C
A10CA11AT12TC13GC14GC15TG16AG17T
G18AA19CC20
M=100111000011
Sub-phase1 (A= 00, T= 01, C= 10, G= 11): M´= CTGAAG
Sub-phashe2 ((AC) (CG) (GT) (TA)): M´´= GATCCT
Sub-phase3 (Indexes): M´´´=8137

Now, embedding phase is finally
completed. Then, sender sends 8,13,7 to
the receiver. In the next section, the

receiver will apply the extracting phase
for extracting the original message by
using three consecutive phases.
3.2 Phase2:
Message

Extracting

Original

Now, receiver takes the secret
message in form of some numbers. For
the purpose of extracting the original
message from DNA reference sequence,
phase two with its sub-phases will
extract the original message, correctly.
M´´´=Secret Message
Finding Index of each Couple of Nucleotides in
DNA Reference Sequence

M´´= Previous Form of M´
Applying Complementary Rules on M´

M´=DNA Sequence
from M
Convert Binary to DNA Nucleotides

M= Message

Figure 4. Phase2: extracting original message

So, the first sub-phase manipulates the
M´´´. Because of the nature of the secret
message which is some sorts of numbers
(exact positions (indexes) of the original
message on DNA reference sequence),
extracting the message starts by finding
the indexes on DNA reference sequence
one by one according to the numbers
which sender has sent in form of the
current secret message. M´´ is the exact
product of the first sub-phase.
Consequently, the second sub-phase
applies complementary rules on M´´ in
order to extracting M´, correctly. The
importance of the M´ is the form of it.
M´ is the last form of message, based on
DNA nucleotides. Converting the M´ to
the M is the third sub-phase.
188

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

Transforming from DNA nucleotides to
the binary is the responsibility of the last
sub-phase. Now, the receiver has truly
extracted the original message M.
Those steps are demonstrated through
the example in below:
DNA Reference Sequence:
AT1CG2AA3TT4CG5CG6CT7GA8GT9C
A10CA11AT12TC13GC14GC15TG16AG17T
G18AA19CC20
M´´´=8137
Sub-phase1 (Indexes): M´´= GATCCT
Sub-phase2 ((AC) (CG) (GT) (TA)): M´=
CTGAAG
Sub-phase3 (A= 00, T= 01, C= 10, G=
11): M=100111000011
So, the receiver extracted the original
message, accurately by using a simple
algorithm. In the next section, security
and liabilities of the algorithm will
inspect, briefly.
3.3 Presenting Results
The final picture of the design phases
of the prototype is presenting results.
The GUI contains two separated parts.
The first (left) is, embedding secret
message and second (right) is, extracting
secret message. Through the each part,
there are some sub-phases to complete
the intention of the parts. In the left side,
in order to complete the embedment,
first, original message decoded to the
binary. The second step is, converting
binary message to the DNA strands by
rules: A=00, T=01, C=10 and G=11.
The results of this step can be seen in
first output textbox. As we mentioned,
we use complementary rules to increase
the complexity by DNA basic synthetic

rules which it says only A-C, C-G, G-T
and T-A can have a chance to synthesize
together. Then, DNA reference sequence
is seen which both of Alice and Bob
have shared between themselves. The
usage of DNA reference sequence is,
finding the index of each couple of
nucleotide.
At the end of the
embedment phase, the secret message
can be seen in group box of the secret
message. Indexes are represented by
numbers. Then Alice clicks the button
“send to Bob”, for sending the secret
message to Bob. Now, extraction phase
is started.

In side of extraction, Bob must
extract the secret message. So, Bob
clicks the extraction button and the
software starts to recover the secret
message. First, indexes are found
through the DNA reference sequence
(which had shared between Alice and
Bob) and corresponding to each index,
its couple nucleotide is extracted. The
output is a DNA sequence. By applying
complementary rules, the previous DNA
sequence is converted to the right DNA
sequence after binary coding in
embedment phase. After that, for each
nucleotide, the corresponding binary
symbol put to the binary original
message textbox. As we know, every
eight bits represents a character. So, by
separating all the eight bits, the final
characters will appear correctly.

4

SECURITY ISSUES

In terms of security, each intruder
must be aware from the following
information, correctly. Without this
fundamental information, possibility of
189

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

extracting original message is near to
zero, scientifically. They are:


DNA reference sequence: there
are 163 million DNA reference
sequence on EBI database.
Therefore, the likelihood of
making a doing well conjecture
by attacker is .



Binary
coding
rule:
as
mentioned, the sender is free to
select any equivalent binary form
for every nucleotide. It means
that, A can be ‘00’, ‘01’, ‘10’, or
‘11’; C can be ‘00’, and so on.
In other words, all the binary
coding rules are 4×3×2×1=24.
So, the likelihood of making
.
correct guess by attacker is



Complementary pairing rule: like
binary coding rule, there is
4×3×2×1=24
complementary
alphabet
among
basic
nucleotides.
Therefore,
the
possibility of making successful
attack is .

Eventually, the final probability of
making a correct and successful guess by
.
attacker is

5

CONCLUSION

At the end of the project, it is sensible
which data hiding with DNA sequences
is a potential and promising way of
hiding secret message within DNA
sequences.
Different
type
of
environment to manipulate the data was
the best part of the project. It means that,
regardless the basic concepts of
Steganography (robustness, capacity,
visibility, and performance), utilizing
biology concepts could bring new

properties to solve ancient difficulties of
algorithm such as complexity besides
performance. At the beginning of the
project, the most important question
which reader thought about it was how it
is possible to convert binary data to
biology and genetics area? As we
showed, DNA coding technology helped
us to transform binary bits to DNA
nucleotides well.
Considering DNA characteristics
brings new ideas in data hiding. DNA
sequences are potential to implement
new data hiding techniques or even
transforming previous schemes to new
one. In this paper, a reference DNA
sequence has been shared between
sender and receiver. Not only this DNA
reference sequence can be retrieved from
EBI [15] or NCBI [14] databases but it
can also be simply selected from any
database. Therefore, by considering any
sort of database, there are 163 million
targets to select it. Virtually, guessing
the correct DNA sequence by attacker is
unachievable.
The crucial feature of the DNA
sequences is visibility. Finding secret
message in a DNA sequence is difficult
because the visibility of the sequences is
very low. Therefore, attacker cannot find
out whether this sequence is a fake or
not. In comparison with previous
techniques, such as in images, not only
implementing this method is not difficult
but also it is formidable to detect, as
well.

190

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)

6

REFERENCES

1. C.C. Chang, C.C. Lin, C.S. Tseng, W.L. Tai,

Reversible hiding in DCT-based compressed
images, Information Sciences 177 (2007)
2. C.C. Chang, W.C. Wu, Y.H. Chen, Joint
coding and embedding techniques for
multimedia images, Information Sciences 178
(2008)
3. C.H. Huang, J.L. Wu, Fidelity-guaranteed
robustness enhancement of blind-detection
watermarking schemes, Information Sciences
179 (2009)
4. H.H. Tsai, D.W. Sun, Color image watermark
extraction based on support vector machines,
Information Sciences 177 (2007)
5. H.W. Tseng, C.P. Hsieh, Prediction-based
reversible data hiding, Information Sciences
179 (2009)
6. C.C. Chang, T.C. Lu, Y.F. Chang, R.C.T. Lee,
Reversible data hiding schemes for
deoxyribonucleic acid (DNA) medium,
International
Journal
of
Innovative
Computing, Information and Control 3 (2007)
7. C.T. Clelland, V. Risca, C. Bancroft, Hiding
messages in DNA microdots, Nature 399
(1999)
8. A. Leier, C. Richter, W. Banzhaf, H. Rauhe,
Cryptography with DNA binary strands,
BioSystems 57 (2000)
9. I. Peterson, Hiding in DNA, Muse (2001)
10.B. Shimanovsky, J. Feng, M. Potkonjak,
Hiding data in DNA, in: Revised Papers from
the
5th International Workshop on
Information Hiding, Lecture Notes in
Computer Science 2578 (2002)
11.B. Alberts, D. Bray, J. Lewis, M. Raff, K.
Roberts, J.D. Watson, Molecular Biology of
the Cell, Garland Publishing, New York &
London, (1994)
12. A.L. Lehninger, D.L. Nelson, M.M. Cox,
Principles of Biochemistry, Worth, New
York, (2000)
13.J. Watson, N. Hopkins, J. Roberts, J. Steitz,
Molecular Biology of the Gene, fourth ed.,
Benjamin
Cummings, Menlo Park, CA,
(1987)
14. National Center for Biotechnology
Information, http://www.ncbi.nlm.nih.gov/
15.
European
Bioinformatics
Institute,
http://www.ebi.ac.uk/
16. H.J. Shiu, K.L. Ng, J.F. Fang, R.C.T. Lee,
C.H. Huang, Information Sciences, Volume
180,
Issue 11, 1 June( 2010)

17. Rauhe, H., Vopper, G., Banzhaf, W.,
Howard, J.C., (1999)
18. B. Shimanovsky, J. Feng, M. Potkonjak,
Hiding data in DNA, in: Revised Papers from
the 5th International Workshop on
Information Hiding, Lecture Notes in
Computer Science 2578 (2002)

191

International Journal on New Computer Architectures and Their Applications (IJNCAA) 2(1): 183-192
The Society of Digital Information and Wireless Communications, 2012 (ISSN: 2220-9085)
Table 1. The mapping of codon to amino acid [18].
UUU →Phe
UUA →Leu
CUU →Leu
CUA →Leu
AUU →Ile
AUA →Ile
GUU →Val
GUA →Val
UUC →Phe
UUG →Leu
CUC →Leu
CUG →Leu
AUG →Ile
AUG →Start
GUC →Val
GUG →Val

UCU →Ser
UCA →Ser
CCU →Pro
CCA →Pro
ACU →Thr
ACA →Thr
GCU →Ala
GCA →Ala
UCC →Ser
UCG →Ser
CCC →Pro
CCG →Pro
ACC →Thr
ACG →Thr
GCC →Ala
GCG →Ala

UAU →Tyr
UAA →Stop
CAU →His
CAA →Gln
AAU →Asn
AAA →Lys
GAU →Asp
GAA →Glu
UAC →Tyr
UAG →Stop
CAC →His
CAG →Gln
AAC →Asn
AAG →Lys
GAC →Asp
GAG →Glu

UGU →Cys
UGA →Stop
CGU →Arg
CGA →Arg
AGU →Ser
AGA →Arg
GGU →Gly
GGA →Gly
UGC →Cys
UGG →Trp
CGC →Arg
CGG →Arg
AGC →Ser
AGG →Arg
GGC →Gly
GGG →Gly

Figure 5. Screenshot of Prototype GUI Showing Embedment and Extraction phases.

192