ghg

PrimerPairs 1 Information (Amplicon length:2375bp) 1.Sequence information: (1)Forward Primer:(Length ：28, Enzyme ：BamHI) 5'CGGGATCCACATTTCTTCACTTCCACAC 5'CGGGATCCACATTTCTTCAC TTCCACAC 3' (2)Reverse Primer:(Length ：28, Enzyme ：XhoI) 5'CCGCTCGAGTAGACTACAGTTGTTATTC 5'CCGCTCGAGTAGACTACAGT TGTTATTC 3' 2.Primer Pair Parameters: (1)Tm(Target Annealing Region of Forward Primer):56°C ； Tm(Target Annealing Region of Reverse Primer):56°C ； Tm difference：0°C. (2)GC%(Target Annealing Region of Forward Primer):40% ； GC%(Target Annealing Region of Reverse Primer):33%. (3)Forward Primer length ：28 nt (target annealing region length ：20 nt);Reverse Primer  Length：28 nt(target annealing region length ：21 nt.) 3. Clone Strategy Information:

（1) Directional cloning with double enzymes insertion! （2）For the two restriction enzymes are adjacent to each other in MCS, it is recommen ded that the plasmid pGEX-5X-1 should be dephosphorized by alkaline phosphatase to reduce the plasmid self-ligation after double digestion. But this is not nece ssary! 4. Restriction Enzyme Information: (1)Promega Inc.'s BamHI(G/GATCC) and XhoI(C/TCGAG) have universal buffer:B. (2)BamHI: Buffer Supplied:E.   Temperature ：37°C； Other information：1.Has Star activity, No Methylation Interference.   WebSite：http://www.promega.com http://www.promega.com/catalog/catalogproducts /catalog/catalogproducts.aspx?categoryname=produc .aspx?categoryname=produc tleaf_502 (3)XhoI: Buffer Supplied:D.   Temperature ：37°C； Other information：1.No Star activity ；CpG methylation Interference ！   WebSite：http://www.promega.com/ http://www.promega.com/catalog/catalogproducts. catalog/catalogproducts.aspx?categoryname=product aspx?categoryname=product leaf_597 (4) Digest Order: [1]Gene can be double digest simultaneously in universal buffer(B) at 37°C ！ [2]Plasmid pGEX-5X-1 can be double digest simultaneously in universal buffer (B) at 37°C ！