Myopia 2010

Published on June 2016 | Categories: Documents | Downloads: 39 | Comments: 0 | Views: 848
of 420
Download PDF   Embed   Report

Comments

Content


Myopia
Animal Models to Clinical Trials
6943 tp.indd 1 4/6/10 5:43:04 PM
This page intentionally left blank This page intentionally left blank
NE W J E RSE Y • L ONDON • SI NGAP ORE • BE I J I NG • SHANGHAI • HONG KONG • TAI P E I • CHE NNAI
World Scientific
Myopia
Animal Models to Clinical Trials
editors
Roger W. Beuerman
Seang-Mei Saw
Donald T. H. Tan
Tien-Yin Wong
Singapore Eye Research Institute
Singapore National Eye Centre
National University of Singapore
6943 tp.indd 2 4/6/10 5:43:04 PM
Library of Congress Cataloging-in-Publication Data
Myopia : animal models to clinical trials / editors, Roger W. Beuerman ... [et al.].
p. ; cm.
Includes bibliographical references and index.
ISBN-13: 978-981-283-297-9 (hardcover : alk. paper)
ISBN-10: 981-283-297-1 (hardcover : alk. paper)
1. Myopia. I. Beuerman, Roger W., 1942–
[DNLM: 1. Myopia. 2. Clinical Trials as Topic--methods. 3. Disease Models, Animal.
WW 320 M9962 2010]
RE938.M963 2010
617.7'55--dc22
2010010940
British Library Cataloguing-in-Publication Data
A catalogue record for this book is available from the British Library.
For photocopying of material in this volume, please pay a copying fee through the Copyright
Clearance Center, Inc., 222 Rosewood Drive, Danvers, MA 01923, USA. In this case permission to
photocopy is not required from the publisher.
Typeset by Stallion Press
Email: [email protected]
All rights reserved. This book, or parts thereof, may not be reproduced in any form or by any means,
electronic or mechanical, including photocopying, recording or any information storage and retrieval
system now known or to be invented, without written permission from the Publisher.
Copyright © 2010 by World Scientific Publishing Co. Pte. Ltd.
Published by
World Scientific Publishing Co. Pte. Ltd.
5 Toh Tuck Link, Singapore 596224
USA office: 27 Warren Street, Suite 401-402, Hackensack, NJ 07601
UK office: 57 Shelton Street, Covent Garden, London WC2H 9HE
Printed in Singapore.
SC - Myopia.pmd 5/6/2010, 4:13 PM 1
Foreword
The field of myopia research is curiously different from research into the
etiology of other medical conditions. Whereas for most conditions, research
on animals models is universally held to be essential for understanding the
etiology and promising treatment modalities, in the case of myopia there is lit-
tle cross-over from laboratory to clinic, despite the dramatic findings that ani-
mals can be made myopic or hyperopic in compensation for defocus imposed
by spectacle lenses — a result consistent with the prevalence of other diseases
being associated with homeostatic mechanisms. Why this disconnect between
animal and clinical studies of myopia? One likely cause is the strong associa-
tion of the prevalence of myopia with educational level, making it seem to be
a uniquely human disorder. This association has led to speculative conjectures
about how myopia develops, but has not led to effective prophylaxis. As a
result of this lack of therapeutic progress, some have rejected the possibility of
arresting myopia by relatively non-invasive visual treatments. Despite several
decades of experimental studies of myopia in animals, many clinicians con-
tinue to consider myopia as a particularly human conditions, or as a conse-
quence of one’s genetic makeup, and regard the animal studies as only weakly
v
b846_FM.qxd 4/13/2010 3:34 PM Page v
vi Foreword
related to why humans become myopic. Given that every few years a new
group of animals is added to the myopia zoo, all compensating for defocus
imposed by spectacle lenses, how likely is it that humans are different?
Were the etiology of human myopia simple this controversy would have
been resolved by now. But many human diseases, such as cardiovascular dis-
ease and diabetes, have a complex etiology, involving both genetic and
behavioral components. How do they differ from myopia? One reason may
be that these diseases can be effectively treated without fully understanding
their underlying causes, whereas in the case of myopia, understanding the
cause of the myopia may well be necessary because simply correcting the
myopia may reinstate the conditions that caused the myopia in the first
place, thereby setting in motion a positive feedback loop, resulting in an
iatrogenic worsening of the myopia. Indeed, some of the possible treatments
(scleral reinforcement, daily atropine administration) might be worse than
the disease, at least for otherwise healthy children with mild myopia.
Only now are we beginning to appreciate and measure in children the
parameters likely to be important indicators of the initiation and progres-
sion of the myopia development. For example, what is the refractive status
of the retinal periphery and how is it affected by visual experience? Does
the periphery become hyperopic relative to the fovea as a cause or conse-
quence of the fovea becoming myopic? Does intensive reading first affect
the central or peripheral refractions? How much of the variability in
peripheral refractions is a function of eye-shape at birth vs the visual sur-
roundings, and how do these interact? If medical students are more likely
to become myopic than athletes, is this due to the total amount of reading
or to the duration of episodes of reading? Or to the amount of time out-
doors? If the latter, is the relevant factor the absence of hyperopic or
myopic defocus at the fovea or in the periphery, or perhaps the enhanced
stimulation of dopamine by bright light? These are issues that can be stud-
ied in both humans and animals, but require experimental manipulations
more difficult than those that have been attempted to date.
An unfortunate consequence of the complicated, multifactorial, nature
of the control of eye growth and development of refractive state is that
the field of research has been nearly completely divided into those doing
animal research and those doing human research. My dear friend and
colleague, the late Sek-Jin Chew, was an exception. He studied muscarinic
receptors in different ocular tissues to understand why atropine reduced
myopic progression. He studied the blinking of chicks to understand
whether brief pulses of increased intraocular pressure would affect ocular
b846_FM.qxd 4/13/2010 3:34 PM Page vi
elongation. And he raised mice wearing a diffuser over one eye under
his bed to explore whether mice might be a useful animal model for
myopia research because of the variety of genetic manipulations available.
When he returned from New York to Singapore he initiated both epi-
demiological and animal research that led to Singapore becoming one of
the world’s leading centers of myopia research. We hope this volume
will be a step in the direction of bringing together the fields of animal and
epidemiological research into the etiology of myopia.
Josh Wallman
Department of Biology
City University of New York
USA
vii Foreword
b846_FM.qxd 4/13/2010 3:34 PM Page vii
Professor Sek-Jin Chew
b846_FM.qxd 4/13/2010 3:34 PM Page viii
ix
Dedication
to the Late Professor Sek-Jin Chew
The late Professor Sek-Jin Chew was the first Singapore ophthalmologist to
be awarded the Fellow College of Surgeons of Edinburgh (FRCS Ed)
Gold Medal, as well as MS and PhD degrees. In 1993, he left Singapore to
pursue a PhD in the USA in the midst of a promising clinical career in pur-
suit of his dream in research. As the first full-time medical staff of the
Department of Ophthalmology in the National University Hospital (NUH),
he had blazed the trail by devoting his career to full-time research, leading
by example in showing how research should and must be integral to the
future of ophthalmology in Singapore. From the start, he clearly identified
that his research focus would primarily be dedicated to myopia, with a
goal towards contributing to our knowledge of causation, and the ultimate
development of new approaches towards retarding myopia progression.
After obtaining his Master’s (in anatomy) from the Louisiana State
University Eye Center in the USA, he went on to attain his PhD degree
(in neuroscience) at the Rockefeller University in 1996. Upon his return,
he immediately set to work in getting the Singapore Eye Research Institute
(SERI) underway.
In those early days, he worked day and night writing grant proposals to
the National Medical Research Council (NMRC), recruiting scientists
locally and overseas, and cajoling medical students to participate in
projects. At the same time, he was networking with industry and overseas
research collaborators to build a name for Singapore as the potential hub
for eye research in Asia.
It was at one of those overseas meetings that Sek-Jin fell ill, collapsed, and
was discovered to have an inoperable brain tumour. Most people would have
resigned themselves to fate and would have given up, but not Sek-Jin. He
worked even harder and faster, knowing that he was living on borrowed
time. Within a very short time, he was able to assemble funds to the tune of
b846_FM.qxd 4/13/2010 3:34 PM Page ix
S$20 million as a five-year grant from the NMRC. At the same time, he set
up the SERI laboratories in the National University of Singapore (NUS) and
built up a team of researchers and support staff from scratch, opening
myopia research clinics. On top of that, he was seeing an increasing number
of patients, recruiting school children for his myopia trials, as well as estab-
lishing successful links and clinical trials with top industry firms such as
Bausch and Lomb, CIBA Vision, and others, which continue to this day.
However, I believe that it was not his brilliant academic achievements or
his lightning speed in getting things done that has touched our lives the
most. I believe all of us will best remember Sek-Jin for his fearless courage,
his boundless optimism in coping with his brain tumour, his total devotion
to his work, in spite of his terminal condition, his genuine friendship, and
the interest and concern shown to even the most junior medical students.
In recognition of his work in myopia research, Sek-Jin was appointed
to a number of international organisations. He was Vice President of the
Myopia International Research Foundation and the Director of its Asia-
Pacific headquarters, based in Singapore. He was also appointed Visiting
Professor at the City University of New York and the New York Eye and
Ear Infirmary, as well as Visiting Scientist at the Rockefeller University.
Sek-Jin was also awarded the SNEC Gold Medal Award in 1997 and the
SNEC International Gold Medal posthumous Award in recognition of his
achievements internationally.
In his short lifespan, Sek-Jin published over 50 papers. He also made
more than 150 presentations, mainly in the field of myopia research, in
regional and international conferences, and in particular at the world’s
foremost research meeting.
Sek-Jin played a pivotal role in establishing links between SNEC and
top universities in the USA, such as Harvard with its strong emphasis in
myopia research, and Johns Hopkins University in a collaborative myopia
study on RGP lens. He was constantly bringing in top scientists from the
USA, UK, Australia, Japan, Taiwan, and China, just to name a few, to cre-
ate opportunities to start new areas of collaboration into the 21st century.
Donald T.H. Tan
FRCSG, FRCSEd, FRCOphth, FAMS
Medical Director, Singapore National Eye Centre
Chairman, Singapore Eye Research Institute
Professor of Ophthalmology
Yong Loo Lin School of Medicine
National University of Singapore
x Dedication
b846_FM.qxd 4/13/2010 3:34 PM Page x
xi Dedication
“My dear friend and colleague, the late Sek-Jin Chew, was an exception. He
studied muscarinic receptors in different ocular tissues to understand why
atropine reduced myopic progression. He studied the blinking of chicks to
understand whether brief pulses of increased intraocular pressure would
affect ocular elongation. And he raised mice wearing a diffuser over one eye
under his bed to explore whether mice might be a useful animal model for
myopia research because of the variety of genetic manipulations available.
When he returned from New York to Singapore, he initiated both epidemio-
logical and animal research that led to Singapore becoming one of the world’s
leading centers of myopia research.”
Professor Josh Wallman
Department of Biology
City College, CUNY, USA
“Dr Sek-Jin Chew who was also my student, was my friend and a leader of
research at the National University of Singapore. We founded the Singapore
Eye Research Institute (SERI) of which he was the founding deputy director.
Sek-Jin’s intense interest in myopia has made Singapore one of the world’s
leading centers for myopic studies.”
Professor Arthur S.M. Lim
Founding Chairman
Singapore Eye Research Institute
“I first met Sek-Jin here in Singapore at the WOC in 1988; he had a dream
to become the first clinician-scientist in Singapore and to establish an eye
research institute here. He achieved both goals in a remarkably short-time
and it is a great honor for all of us to recognize that his dream has taken root
and grown. Sek and Esther were married while he worked in my lab in the US
and they became dear friends.
Roger W. Beuerman
Singapore Eye Research Institute
Duke-NUS
SRP Neuroscience and Behavioral Disorders
Yong Loo Lin School of Medicine
National University of Singapore
b846_FM.qxd 4/13/2010 3:34 PM Page xi
“Despite the onset of a fatal illness, he continued to direct the institute,
organize its programmes, and produce a flood of ideas to encourage his team.”
Dr J.F. Cullen
Royal College of Surgeons of Edinburgh Newsletter
No. 55, Singapore 1999
“There are a lot of capable people, but few are both capable and respectable
like Sek-Jin…. He was visionary, selfless, and both a good team leader and
team player. One of his favorite quotes was, ‘Let’s work together.”’
Professor Dennis Lam
Chairman
Department of Ophthalmology
and
Visual Sciences of the Chinese University of Hong Kong
Hong Kong
Sek-Jin was a dedicated and highly motivated researcher who did not spare
himself even when he knew that a brain tumour threatened his long-term
future. He directed SERI up until his life was cruelly cut short. Together
in New York, Glasgow and in Singapore, Sek-Jin and I put together a plan
for what became the Singapore Eye Research Institute. It is a sadness
that he was not spared to see the flowering of the seed that was planted at
that time.
Wallace S. Foulds, CBE, MD, ChM
DSc (Hon), FRCS (Eng & Glasg), FRCOphth
Singapore Eye Research Institute
Singapore
University of Glasgow
United Kingdom
xii Dedication
b846_FM.qxd 4/13/2010 3:34 PM Page xii
xiii
Message
Myopia: Clinical Analysis to Animal Models
Dedicated to the late Professor Sek-Jin Chew
Myopia has for some years been of great concern to Singaporeans because
of its increased incidence, especially among the Chinese.
The prevalence of myopia in Singapore now ranges from 25% to 50%
among students, and up to 80% among undergraduates. Paradoxically,
this problem also presents ophthalmologists with opportunities to make
significant contributions.
The problem of myopia is complex. We are still unclear in biological
terms how myopia occurs. Is it due to the collagen at the posterior pole? Is
this collagen different from that present in the rest of the sclera? What is
the role of retinal pigment epithelium? The application of molecular and
cell biology may lead to some answers to the numerous questions regard-
ing the etiology of myopia.
A worrying medical point is that when myopia is high, e.g. six dioptres
or more, degenerative changes may develop in the retina affecting the
macula and leading to poor vision in middle age or peripheral retinal
degeneration may occur leading to retinal tear and detachment.
We have known for many years that myopia tends to run in families
and genetic studies will be valuable. What environmental factors aggra-
vate myopia? Is myopia associated with prolonged use of the computer or
with prolonged reading? Will eye exercises help? Will genetic therapy
help? Do we know of factors that can slow down the progress of myopia?
There are numerous unanswered questions.
Myopia is more common among the Chinese. “Why?” The late
Professor Ida Mann noted that the hunters of Europe like the Germans
and the aborigines of Australia were not myopic because if they could see
b846_FM.qxd 4/13/2010 3:34 PM Page xiii
xiv Message
far, they would not survive. In contrast, Chinese scholars, craftsmen and
artists engaged in near work survived. This might explain why, over the
generations, myopia has become prevalent among the Chinese.
There are many studies to slow down the progress of myopia — eye
exercises, eye massages, avoidance of prolonged reading, use of Atropine,
use of large letters on white or black boards in school and a host of other
methods.
Many have sought alternatives to the use of spectacles. Contact lenses
became popular but their use is not without problems. In fact, the use of
soft lenses can lead to infection which has caused blindness. When the
patient is 20-year or older, his vision can be improved with surgery, the
most popular of which is the use of the excimer laser. More recently,
LASIK — where a thin layer of the cornea is lifted before the application
of laser — has been used. There are now several new lasers and methods
of refractive surgery being introduced. This book addresses myopia and
I believe that readers will find it useful in their understanding of the
condition.
I am delighted that this publication is dedicated to one of the world’s
most enthusiastic researchers on myopia — the late Dr Sek-Jin Chew who
was also my student, my friend and a leader of research at the National
University of Singapore. We founded the Singapore Eye Research Institute
(SERI) of which he was the founding deputy director. Sek Jin’s intense
interest in myopia has made Singapore one of the world’s leading centres
for myopic studies.
While we wait for research to give us more answers, this book is a
useful guide for anyone wishing to learn more about myopia.
Professor Arthur Lim, MD (Hon), FRCS
Founding Chairman
Singapore Eye Research Institute
b846_FM.qxd 4/13/2010 3:34 PM Page xiv
xv
Contents
Foreword v
Dedication ix
Message xiii
About the Editors xix
List of Contributors xxiii
Acknowledgments xxvii
Section 1 Epidemiology and Risk Factors 1
Chapter 1.1 Epidemiology of Myopia and Myopic Shift 3
in Refraction
Barbara E.K. Klein
Chapter 1.2 Environmental Risk Factors for Myopia in Children 23
Wilson C.J. Low, Tien-Yin Wong and Seang-Mei Saw
Chapter 1.3 Gene-Environment Interactions in the Aetiology 45
of Myopia
Ian G. Morgan and Kathryn A. Rose
Chapter 1.4 The Economics of Myopia 63
Marcus C.C. Lim and Kevin D. Frick
b846_FM.qxd 4/13/2010 3:34 PM Page xv
Section 2 Clinical Studies and Pathologic Myopia 81
Chapter 2.1 Quality of Life and Myopia 83
Ecosse L. Lamoureux and Hwee-Bee Wong
Chapter 2.2 Ocular Morbidity of Pathological Myopia 97
V. Swetha E. Jeganathan, Seang-Mei Saw
and Tien-Yin Wong
Chapter 2.3 Myopia and Glaucoma 121
Shamira A. Perera and Tin Aung
Chapter 2.4 The Myopic Retina 137
Shu-Yen Lee
Chapter 2.5 Retinal Function 149
Chi D. Luu and Audrey W.L. Chia
Section 3 Genetics of Myopia 161
Chapter 3.1 New Approaches in the Genetics of Myopia 163
Liang K. Goh, Ravikanth Metlapally
and Terri Young
Chapter 3.2 Twins Studies and Myopia 183
Maria Schäche and Paul N. Baird
Chapter 3.3 TIGR, TGFB1, cMET, HGF, Collagen Genes, 201
and Myopia
Chiea-Chuen Khor
Chapter 3.4 Statistical Analysis of Genome-wide Association 215
Studies for Myopia
Yi-Ju Li and Qiao Fan
xvi Contents
b846_FM.qxd 4/13/2010 3:34 PM Page xvi
Section 4 Animal Models and the Biological Basis 237
of Myopia
Chapter 4.1 The Relevance of Studies in Chicks for 239
Understanding Myopia in Humans
Josh Wallman and Debora L. Nickla
Chapter 4.2 The Mechanisms Regulating Scleral Change 267
in Myopia
Neville A. McBrien
Chapter 4.3 The Mouse Model of Myopia 303
Frank Schaeffel
Chapter 4.4 Gene Analysis in Experimental Animal Models 331
of Myopia
Roger W. Beuerman, Liang K. Goh and
Veluchamy A. Barathi
Section 5 Interventions for Myopia 343
Chapter 5.1 Atropine and Other Pharmacological Approaches 345
to Prevent Myopia
Louis M.G. Tong, Veluchamy A. Barathi
and Roger W. Beuerman
Chapter 5.2 Physical Factors in Myopia and Potential 361
Therapies
Wallace S. Foulds and Chi D. Luu
Index 387
xvii Contents
b846_FM.qxd 4/13/2010 3:34 PM Page xvii
b846_FM.qxd 4/13/2010 3:34 PM Page xviii
This page intentionally left blank This page intentionally left blank
About the Editors
Roger W. Beuerman, PhD
Singapore Eye Research Institute
Duke-NUS
SRP Neuroscience and Behavioral Disorders
Ophthalmology
Yong Loo Lin School of Medicine
National University of Singapore
Roger Beuerman is currently Senior Scientific Director of the Singapore Eye
Research Institute; Professor of Neuroscience and Behavioral Disorders at
the DUKE-NUS School of Medicine; Adjunct Professor of Ophthalmology
at the National University of Singapore; Adjunct Professor of Chemical and
Biomedical Engineering at the Nanyang Technological University; and
Senior Scientist at the Bioinformatics Institute. He has more than 20 years’
experience in translational research in ophthalmology. He is an ARVO
Fellow; a Fellow of the Alcon Research institute, and the Paolo Foundation
in Helsinki, Finland. He has been a Visiting Professor in the Department of
Ophthalmology and Visual Sciences at the Chinese University of Hong
Kong, the Department of Ophthalmology at the University of Helsinki, and
the Department of Ophthalmology of Tianjin, China. He has received
many awards, including the CIBA-CVO Research Excellence Award, the
Everett Kinsey Award (CLAO), the 2nd Chew Sek-Jin Lecture, Bireswar
Chakrabarti Memorial Oration of the Indian Eye Research Group, LA
Technology Award, and recently the President’s (Singapore) First Science
and Technology Award. He has previously edited books on corneal wound
healing and dry eye, has more than 220 publications, and sits on several
editorial boards, including Cornea, Ocular Surface, and Journal of Ocular
Pharmacology and Therapeutics.
xix
b846_FM.qxd 4/13/2010 3:34 PM Page xix
Seang-Mei Saw, MBBS, MPH, PhD
Department of Epidemiology & Public Health
Yong Loo Lin School of Medicine
National University of Singapore
Singapore Eye Research Institute
Seang-Mei Saw is currently an Associate Professor at the Department of
Epidemiology and Public Health, and Vice-Dean (Research Preclinical),
Yong Loo Lin School of Medicine, National University of Singapore
(NUS). She received her MBBS degree from NUS and both her MPH and
PhD from the Johns Hopkins Bloomberg School of Public Health. Her
primary research interests are related to the epidemiology, genetics and
gene-environment interactions for myopia and other eye diseases. She has
published more than 200 peer-reviewed articles in international journals,
including the Lancet and Journal of the American Medical Association
(JAMA). She is currently the PI and Co-I of grants totaling >$15 million
from the BMRC, NMRC, NIH and NHMRC (Australia). She supervises
30 research staff, 3 post-doctoral research fellows and 6 PhD and MSc
students.
Seang-Mei is an Editorial Board member of Investigative Ophthalmology
and Visual Science, Ophthalmic and Physiologic Optics, and the Annals
Academy of Medicine (Singapore). She is the recipient of the Garland
W. Clay Award (2006); the Great Women of our Times Award, Science and
Technology Category, Singapore (2006); the American Academy of
Ophthalmology (AAO) Achievement Award (2009); and the NUS School
of Medicine Faculty Research Excellence Award (2009). Seang-Mei was the
past Chair of the 11th International Myopia Conference held from 16th to
18th August 2006 in Singapore, and is currently Chair of the Program
Committee, Clinical/Epidemiologic section, Association for Research in
Vision and Ophthalmology (ARVO).
xx About the Editors
b846_FM.qxd 4/13/2010 3:34 PM Page xx
Donald T.H. Tan, FRCSG, FRCSEd,
FRCOphth, FAMS
Singapore National Eye Centre
Singapore Eye Research Institute
Yong Loo Lin School of Medicine
National University of Singapore
Donald Tan is the Medical Director of the Singapore National Eye Centre
(SNEC), Chairman of the Singapore Eye Research Institute (SERI) and
tenured professor at the Department of Ophthalmology at the National
University of Singapore. He heads the SNEC Cornea and Refractive
Services and is also Medical Director of the Singapore Eye Bank.
A corneal and refractive surgeon by training, Professor Tan’s research
contributions lie in new forms of lamellar keratoplasty, ocular surface
and stem cell transplantation, and artificial cornea surgery, refractive
surgery trials, and epidemiological studies on myopia and clinical trials
on various approaches to retarding myopia progression. To date, he has
published 226 peer-reviewed articles, and contributed 18 book chapters,
and has also trained 22 corneal fellows from 13 countries.
Professor Tan was awarded the Asia-Pacific Academy of Ophthalmology
De Ocampo Award in 2001, a 2006 AAO Distinguished Achievement
Award, and a Singapore National Public Health Award for first identifying
and stemming the 2006 global outbreak of contact lens solution-related
Fusarium keratitis. In 2009, he was awarded the 2009 Casebeer Award by
the International Society of Refractive Surgery (ISRS) and the American
Academy of Ophthalmology (AAO), for his contributions to research in
the field of refractive surgery.
He is currently Vice-President/President Elect of The Cornea Society,
and the founding President of the Asia Cornea Society (ACS) and the
Association of Eye Banks of Asia (AEBA).
xxi About the Editors
b846_FM.qxd 4/13/2010 3:34 PM Page xxi
Tien-Yin Wong, MBBS, M.Med(Ophthl), FRCSEd,
FRANZCO, MPH, PhD
Singapore National Eye Centre
Singapore Eye Research Institute
Department of Ophthalmology
Yong Loo Lin School of Medicine
National University of Singapore
Centre for Eye Research Australia &
Department of Ophthalmology
The University of Melbourne
Royal Victorian Eye & Ear Hospital Australia
Tien-Yin Wong is currently Professor and Director of the Singapore Eye
Research Institute, National University of Singapore and Senior Consultant
Ophthalmologist at the Singapore National Eye Centre and National
University Health System. He is concurrently Professor of Ophthalmology
at the Centre for Eye Research Australia, the University of Melbourne.
Professor Wong is a retinal specialist and leads a research program on
the epidemiology, impact and treatment of retinal diseases, including dia-
betic retinopathy, age-related macular degeneration, and retinal vein
occlusion. A particular focus of his work is on early retinal vascular
changes and the use of novel retinal imaging techniques to predict cardio-
vascular disease. He has published more than 400 peer-reviewed papers,
including papers in the New England Journal of Medicine, the Lancet, and
the Journal of the American Medical Association and has written 3 books
that are widely used in ophthalmology.
For his research, Professor Wong has been recognized nationally and
internationally with awards not only in ophthalmology, but also in the
fields of cardiovascular disease and diabetes. He was the recipient of the
Alcon Research Institute Award, the Novartis Prize in Diabetes (Global
Young Investigator) award, the Australian Commonwealth Health
Minister’s Award for Excellence in Health and Medical Research and the
Sandra Doherty Award from the American Heart Association. Prof. Wong
is the Executive Editor of the American Journal of Ophthalmology, and on
Editorial Board of three other journals, Investigative Ophthalmology and
Visual Sciences, Ophthalmic Epidemiology and Diabetes Care. He
currently supervises 30 research staff and has previously trained 10 post-
doctoral research fellows and PhD students. He is currently supervising 4
PhD students and 4 postdoctoral fellows.
xxii About the Editors
b846_FM.qxd 4/13/2010 3:34 PM Page xxii
xxiii
List of Contributors
Tin Aung, FRCSEd, FRCOphth,
FAMS, PhD
Singapore National Eye Centre
Singapore Eye Research Institute
Yong Loo Lin School of Medicine
National University of Singapore
Singapore
Paul N. Baird, PhD
Centre for Eye Research
Australia
University of Melbourne
Royal Victorian Eye and Ear
Hospital
Australia
Veluchamy A. Barathi, BVSc,
PhD
Singapore Eye Research Institute
Singapore
Roger W. Beuerman, PhD
Singapore Eye Research Institute
Duke-NUS, SRP Neuroscience
and Behavioral Disorders
Ophthalmology, Yong Loo Lin
School of Medicine
National University of Singapore
Singapore
Audrey W.L. Chia, MBBS(Hons),
FRANZCO
Singapore National Eye Centre
Singapore Eye Research Institute
Singapore
Qiao Fan, M.S.
Department of Epidemiology and
Public Health
National University of Singapore
Singapore
Wallace S. Foulds, CBE MD,
ChM, DSc (Hon), FRCS (Eng,
Glasg), FRCOphth
Singapore Eye Research Institute
Singapore
University of Glasgow
United Kingdom
Kelvin D. Frick, PhD, MA
Johns Hopkins Bloomberg
School of Public Health
USA
b846_FM.qxd 4/13/2010 3:34 PM Page xxiii
xxiv List of Contributors
Liang K. Goh, PhD
Duke-National University of
Singapore
Graduate Medical School
Singapore
V. Swetha E. Jeganathan,
MBBS, MAppMgt (Hlth), DSc
Centre for Eye Research
Australia
University of Melbourne
Australia
The Tun Hussein Onn National
Eye Hospital, Malaysia
Singapore Eye Research Institute
Singapore
Chiea-Chuen Khor, MBBS, D.Phil
Division of Infectious Diseases
Genome Institute of Singapore
Agency for Science
Technology and Research
Centre for Molecular
Epidemiology
National University of Singapore
Singapore
Barbara E.K. Klein, MD, MPH,
FACPM, FACE, FAAO
Department of Ophthalmology
and Visual Sciences
University of Wisconsin School of
Medicine and Public Health
USA
Ecosse L. Lamoureux, MSc., PhD
Centre for Eye Research Australia
The Royal Victorian Eye and Ear
Hospital, University of Melbourne
Australia
Singapore Eye Research Institute
Singapore National Eye Centre
Singapore
Shu-Yen Lee, FRCSEd(Ophth),
FAMS
Singapore National Eye Centre
Duke-National University of
Singapore
Graduate Medical School
Singapore
Yi-Ju Li, PhD
Department of Biostatistics and
Bioinformatics
Duke University Medical Center
Center for Human Genetics
Duke University Medical Center
USA
Marcus C. C. Lim, FRCS (Late)
Singapore National Eye Centre
Singapore Eye Research Institute
Singapore
Wilson C.J. Low, BSc
Department of Epidemiology &
Public Health
Yong Loo Lin School of Medicine
National University of Singapore
Singapore
Chi D. Luu, PhD
Singapore Eye Research Institute
Singapore
Macular Research Unit, Centre
for Eye Research Australia
The University of Melbourne
Royal Victorian Eye & Ear
Hospital
Australia
b846_FM.qxd 4/13/2010 3:34 PM Page xxiv
xxv List of Contributors
Neville A. McBrien, BSc, PhD
Department of Optometry and
Vision Sciences
University of Melbourne
Australia
Ravikanth Metlapally, PhD
Duke Center for Human Genetics
Durham NC
USA
Ian G. Morgan, BSc, PhD
ARC Centre of Excellence in
Vision Science, Research School
of Biology
Australian National University
Australia
Debora L. Nickla, PhD
New England College of
Optometry
Boston Massachusetts
USA
Shamira A. Perera, MBBS(Hons),
BSc(Hons) FRCOphth
Singapore National Eye Centre
Singapore Eye Research Institute
Singapore
Kathryn A. Rose, PhD
Discipline of Orthoptics, Faculty
of Health Sciences
University of Sydney
Australia
Seang-Mei Saw, MBBS, MPH,
PhD
Department of Epidemiology &
Public Health
Yong Loo Lin School of Medicine
National University of Singapore
Singapore
Maria Schäche, PhD
Centre for Eye Research
Australia
University of Melbourne
Royal Victorian Eye and Ear
Hospital
Australia
Frank Schaeffel, PhD
Section of Neurobiology of the
Eye
Ophthalmic Research Institute
Eberhart-Karls-University
Tübingen
Germany
Donald T.H. Tan, FRCSG,
FRCSEd, FRCOphth, FAMS
Singapore National Eye Centre
Singapore Eye Research Institute
National University of Singapore
Singapore
Louis M.G.Tong, FRCSEd, PhD
Singapore National Eye Centre
Singapore Eye Research Institute
Duke-NUS Graduate Medical
School
Singapore
Josh Wallman, PhD
Department of Biology
City College, CUNY
USA
b846_FM.qxd 4/13/2010 3:35 PM Page xxv
xxvi List of Contributors
Hwee-Bee Wong, MSc
Health Services Research and
Evaluation Division,
Ministry of Health
Department of Epidemiology &
Public Health
Yong Loo Lin School of
Medicine
National University of
Singapore
Singapore
Tien-Yin Wong, M.Med(Ophthl),
FRCSEd, FRANZCO, MPH, PhD
Singapore National Eye Centre &
Singapore Eye Research
Institute & Department of
Ophthalmology,
Yong Loo Lin School of Medicine,
National University of Singapore
Singapore
Terri L. Young, MD
Duke-National University of
Singapore
Graduate Medical School
Duke University Medical Center-
Duke Eye Center and the Duke
Center for Human Genetics
USA
b846_FM.qxd 4/13/2010 3:35 PM Page xxvi
xxvii
Acknowledgments
We would like to thank the project team at the Singapore National Eye
Centre for their dedication in managing and coordinating the develop-
ment of this publication.
Singapore National Eye Centre
Advisor
Charity Wai
Project Manager
Kathy Chen
Cover Design
Paul Kwang-Yeow Chua
Kasi Sandhanam
Joanna Peh Wei-Fang
We would also like to thank the editorial team at the World Scientific
Publishing Singapore for their professionalism and technical support
World Scientific Publishing
Editor
Sook-Cheng Lim
Typesetter
Stallion Press
Proofreader
Meng-Wai Chow
Artist
Hui-Chee Lim
b846_FM.qxd 4/13/2010 3:35 PM Page xxvii
b846_FM.qxd 4/13/2010 3:35 PM Page xxviii
This page intentionally left blank This page intentionally left blank
Epidemiology and Risk Factors
Section 1
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 2
This page intentionally left blank This page intentionally left blank
Epidemiology of Myopia and Myopic
Shift in Refraction
Barbara E.K. Klein*
There have been many recent publications concerning myopia. Some are
population-based while others reflect specific exposure groups. This chapter
includes the findings from many of these publications and describes some of
the risk factors/risk indicators for myopia, including personal exposures,
family similarities and possible genetic correlates of his or her refractive state.
Introduction
Myopia has become a focus of ocular epidemiologic research worldwide
for many reasons. There are no current national prevalence estimates of
myopia in U.S. children, but the Eye Disease Prevalence Research Group
estimated that there were 30,358 cases of myopia of −1.0 D or less (more
minus) in U.S. adults 40-years of age or older, of whom 5308 had a refrac-
tive error of −5.0 D or less.
1
It has been estimated that the costs of cor-
recting myopic refractive errors, either by spectacles or contact lenses, was
about 2 billion dollars per year in the U.S. in 1983–87,
2
and about 4.6 bil-
lion dollars more recently; according to the authors, this is a conservative
estimate.
3
Current cost estimates would need to include more modern
methods of refractive surgery primarily involving the cornea and lensec-
tomy with or without lens implant. These costs are a significant burden for
individuals and health systems that are privately or publicly funded. More
importantly, myopia, especially higher degrees of myopia, has occupa-
tional, medical and quality of life consequences for individuals.
3
1.1
*Department of Ophthalmology and Visual Sciences, University of Wisconsin, School of Medicine
and Public Health, Madison, 610 North Walnut Street, 4th Floor WARF, Madison, WI, 53726-2336
USA. E-mail: [email protected]
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 3
Myopia has been considered to be a problem with origins in childhood.
The estimated prevalence in 6-year-olds is 2% and in 15-year-olds, 15%.
4
However, adult onset myopia is not an infrequent occurrence. Furthermore,
myopic shifts in refraction can occur across the lifespan, although more
common in the first two decades than in older persons, and affects those
with hypermetropic refractive errors and emmetropes as well as myopes.
Thus, this chapter will describe the distribution of myopia and myopic
shifts in refraction as reflected in a (non-scientific) sample of studies
worldwide in children and adults.
In addition, risk factors that have been evaluated for myopia will be
briefly described. The list of risk factors includes a brief description of
familiality or family aggregation and in some cases, actual genetic loci.
The reader should be aware that a comprehensive review paper of epi-
demiology of myopia was published in 1996.
5
In addition, a description of
the literature on refraction in general was published in 2008.
6
The mate-
rial in this chapter overlaps in part the information in these two sources.
Methodologic Issues
Studies reported upon in this chapter are of several types, including tradi-
tional population-based surveys, studies of special exposure groups such
as students, occupationally exposed workers, social or ethnic groups, and
rural or urban groups. Some studies were performed on convenience sam-
ples, although these were largely avoided. In addition, some studies are
cross-sectional, while others incorporate longitudinal follow-up. Some
case-control studies have been included as well. Risk factors or risk
indicators of myopia are briefly discussed. In addition, no survey of risk
factors associated with virtually any condition is complete without at least
a brief review of genetic correlates of the condition. To that end, this
chapter includes some investigations that have approached the study of
myopia using the tools of statistical genetics, with data sources from
population-based, family, and twin studies, and combinations of these
designs. The field of genetics is progressing rapidly and will be further
advanced by the time of the publication of this tome. Nevertheless,
although the content will be somewhat dated, the approach to investigat-
ing these important determinants will still be relevant.
Measurement techniques of refraction varied between studies.
7
In most
studies in children and in some studies in adults, cycloplegic agents were
4 B.E.K. Klein
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 4
instilled prior to refraction and, among these, different pharmacologic
agents were used, likely resulting in some variation in the actual amount
of cycloplegia attained. In other studies, no cycloplegic agents were used.
The data may have been reported only as continuous data with mean
refraction given, while in other cases, the authors reported the data in
categories. When the latter was so, the category limits for myopia (and
for hyperopia and emmetropia as well) may have differed between stud-
ies. Objective refraction was performed in some studies and subjective
refraction or refinement in others. In addition, the testing for refraction
was based on best corrected distance acuity. This may differ with regard
to the use of charts or projection and distances. These details may not
have been reported in the publications reviewed. Automated refractors
may have been used and these devices differ in design, and consequently
could yield systematic differences between results. Lastly, many studies
reported the spherical equivalent, while others only gave spherical refrac-
tion. All these factors are likely to have led to variation in the reported
measure of the refraction, resulting in different estimates of the propor-
tion of persons classified as myopic (and emmetropic and hyperopic). In
some cases, the “errors” so induced may not have been unbiased. In addi-
tion, there were, no doubt, actual errors and statistical variation around
the measurements that were, in general, not reported at all. Despite these
concerns, some common findings emerged and some directions for fur-
ther research have been provided as well. Because the thrust of this volume
is on myopia, a refractive state, ocular biometry will not be discussed,
although myopia results anatomically and physiologically from the
biometry.
Review of Studies (Table 1)
For the sake of space and because of the possibility that there have
been temporal changes in the distribution of refraction, only the more
recent publications have been reviewed for the purpose of this chapter.
Epidemiologic studies of refraction have burgeoned and now there are
data from studies across the age span and in many different ethnic and cul-
tural groups. For the sake of brevity, a limited amount of descriptive mate-
rial from each study has been included; however, interested readers could
refer to the reference citations. Still, this review is not exhaustive but is
merely a (non-systematic) sample of studies of myopia.
5 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 5
6
B
.
E
.
K
.

K
l
e
i
n
Table 1. Overview of Studies
Population- Age Definition of Prevalence
Location/Study based N* (Years) Cycloplegic Myopia (SE) (%) Eye
Studies in Children
CLEERE*
,10
No 2583 6–14 Yes ≤ −0.5 11.6 Right
≤ −0.75 10.1 Right
Sydney Myopia Study
8,76
Yes 1724 5.5–8.4 Yes ≤ −0.5 1.4 Right
Hyderabad, India
11
< 15 years Yes 663 Yes < −0.5 4 Worse
Oman
53
No 2853 < 16–19+ Yes ≤ −0.5 Not given Worse
Hong Kong
77
Yes 7560 5–16 Yes ≤ −0.5 Right
Singapore
12,43
No 1453 7–9 Yes ≤ −0.5 29.0 Right
Jordan
39
No 1777 12–17 Not given < −0.5 17.6 Not given
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
1
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

6
7
E
p
i
d
e
m
i
o
l
o
g
y

o
f

M
y
o
p
i
a
Table 1. (Continued)
Population- Age Definition of Prevalence
Location/Study based N* (Years) Cycloplegic Myopia (SE) (%) Eye
Studies in Adults
Hyderabad, India
11
≥ 15 years Yes 1722 No 19 Worse
Blue Mountains, Australia
18
Yes 3650 49–97 No ≤ −0.5 14 Right
Baltimore Urban
19
Yes 5036 40–80+ No ≤ −0.5 25 Right
LALES
20
Yes 5588 40+ No ≤ −0.5 Not given Right
BDES
15
Yes 4533 43–86 No ≤ −0.5 26.2 Right
VIP
17
Yes 4506 40–80+ No ≤ −0.5 17.0 Right
Barbados
16
Yes 4330 40–84 No ≤ −0.5 21.9 Right
Auckland, New Zealand
78
No 559 40–45
Buenos Aires, Argentina
79
No 1518 43.2 ± 9.8 No ≤ −0.5 29.2 Right
Abbreviations: SE = spherical equivalent; CLEERE = Collaborative Longitudinal Evaluation of Ethnicity and Refractive Error; LALES = Los Angeles Latino
Epidemiologic Study; BDES = Beaver Dam Eye Study; VIP = Visual Impairment Project.
* = with refraction data.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
1
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

7
The Sydney Myopia Study evaluated refraction in a sample of 6- to
7-year-old school children.
8
The mean spherical equivalent refraction in
these children was +1.26 D in the right eyes. The boys were slightly more
likely to be myopic than the girls, and white children were slightly less
likely to be myopic than non-whites. In the 12-year-old children in that
study, spherical equivalent was less positive than in the younger children.
9
Investigators from six sites in the U.S. pooled their data on refractive
errors and ocular biometry in school children ages 6 to 14+ years.
10
The
students were from different ethnic backgrounds. They found no differ-
ence in average spherical equivalent between girls and boys; there was a
shift towards myopia with increasing age in both.
There were 663 subjects who were 15-years of age or younger in the
Andhra Pradesh Eye Disease Study
11
(Table 1). Myopia was less common
in those 15-years of age and younger (about 4%) than in older persons
(19%). The first reported myopes were about 5-years-old.
The prevalence of myopia in Chinese school children 7–9-years of age
in Singapore was 29%, with successively higher prevalences with increas-
ing age.
12
The age when the tendency for increasing myopia levels off is
uncertain. Studies of university students suggest that this may continue
into the third decade, although there may be the confounding effect of
near work activities in these subjects.
13,14
The Beaver Dam Eye Study reported that 28.1% of women and 24.0%
of men 43–86-years of age were myopic. A difference between men and
women was true throughout the age range.
15
Overall, the prevalence was
26.2%. Wu reported that the prevalence of myopia decreased with age
until 60 years but increased thereafter in a population of Afro-
Caribbeans.
16
The Visual Impairment Project conducted in Victoria,
Australia, included urban and rural persons.
17
Prevalence decreased with
increasing age; the overall prevalence was 17%. Overall, sex was not asso-
ciated with myopia, but after age correction, women were slightly more
likely to have a hyperopic refractive error. The Blue Mountains Eye Study
is a population-based study of 3654 persons, 49–97-years of age.
18
The
overall estimate of prevalent myopia was 14%. The Baltimore Eye Survey
reported on refraction in 2200 African Americans and 2659 white
Americans in Baltimore.
19
Overall, 25% of the population was myopic and
whites had higher myopia on average than blacks. Myopia declined with
increasing age. The Los Angeles Latino Eye Study found that in 5588 adults
40-years of age or older, the mean spherical equivalent was 0.02 D (+/−1.66)
in men and 0.18 D (+/−) in women,
20
and that on average there was 0.04 D
8 B.E.K. Klein
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 8
increase in spherical error per year for those 40- to 79-years of age, and
−0.07 D per year for those 80-years of age and older.
Many of the studies on prevalences or case-control studies with past
ocular history available reported on myopic shifts in refraction, i.e. a
change in the sphere or spherical equivalent of the refractive correction in
a negative direction even within the hyperopic range. In general, in chil-
dren there is a shift towards more myopic refraction with increasing age.
Thorn and colleagues have modeled myopia progression in children using
double exponential growth function (Gompertz function).
21,22
These
investigators estimated that refraction stabilizes in 80% of children by
about 19-years of age. This tendency extends past ages that are usually
considered to be childhood.
In a group of 432 patients being followed up regularly at a clinic, longi-
tudinal measures of refraction were reviewed over about a 10-year course.
23
Myopic shifts in refraction occurred in some persons through the seventh
decade of life. The mean amount of shift decreased with increasing decade
of life, from an average of −0.6 D in the third decade to −0.4 D in the
fourth decade and −0.3 D in the fifth decade.
Cohort Effects on Myopia
Mutti and Zadnick reported on an apparent birth cohort effect on
myopia in three population-based and one family-oriented study of
refraction.
24
They found that the prevalence of myopia standardized to
44.5- to 49.5-years of age increased in cohorts from about 1900 to about
1940. The most impressive increase in prevalence occurred in those born
between 1920 and 1935. Wensor observed, aside from a higher preva-
lence of myopia in those of younger age in the Visual Impairment
Project, that those in younger age groups were more likely to have reported
wearing a spectacle correction for distance between 10- and 19-years
of age.
17
In addition, those who were 40–49-years of age reported wear-
ing a myopic correction at age 40 more often as compared with those
who were 70-years of age or older at the time of the survey. Bengtsson
and Grodum reported decreased spherical equivalent power in 65- to
74-year-olds in persons with more recent birth year.
25
Lee and colleagues
found a birth cohort effect in adults participating in the Beaver Dam Eye
Study.
26
They found that for persons of the same age, those born more
recently were more likely to be myopic than those born in earlier years.
9 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 9
In summary, in adults of largely European background there appears to
be a cohort effect on myopia.
Risk Factors for Myopia
Risk factors for myopia or myopic shifts in adults are given in Table 2. A
description of these and other risk factors in children and in adults is given
below.
Near work
Much of the information on the association of near work with myopia in
children is inferred from estimated intensity of school work or reading. A
study in Hong Kong examined fishing families and found an association
between education and myopia.
27
Hepsen and colleagues reported on
greater frequency of progression of myopia in children from private schools
as compared with apprentices in a skilled labor group.
28
Saw and colleagues
reported a significant association between the degree of myopia and the
10 B.E.K. Klein
Table 2. Selected Characteristics* Associated with Myopia in Adults
SES/ Near Work/ Nuclear
Location/Study Age Gender Income Education Cataract Occupation
Andhra Pradesh
11
+ 0 0 + +
Blue Mountains
18,80
+ +
Baltimore Eye Survey
19
+ + +
BDES
15,36,56
+ + 0 + + 0
VIP
17
+ + + + + +
LALES
20
+ + +
Barbados
16,37
+ + ** + +
Tanjong Pagar
33,34
Inf. Inf. + + +
Reykjavik
81
+ 0 +
Abbreviations: SES = socioeconomic status; BDES = Beaver Dam Eye Study; VIP = Visual Impairment
Project; LALES = Los Angeles Latino Epidemiologic Study; Inf. = inferred.
* Direction not given as associations may vary by strength and direction between categories of some
characteristic.
** Near work was associated but not education.
+ Association found.
0 Association evaluated but not found.
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 10
number of books read per week in a group of Singaporean school children.
12
In a study of Los Angeles and Australian 6- and 12-year-olds, parents’ report
of children’s near work activity was modestly associated with myopia.
9
Recently, Rose and colleagues reported a marked difference in the
prevalence of myopia between Australian and Chinese Singaporean 6- to
7-year-old school children. The prevalence in Australians was 3.3% and in
Singaporeans, 29.1%, despite the fact that the Australians read more books
per week and did more hours of homework per week.
29
The possibility
that recent increases in years of preschool instruction for Singaporean
children may be related to the higher prevalence in these children.
Khader and colleagues found that myopic children were likely to spend
more time reading and writing and using the computer than their non-
myopic school mates,
30
but the analyses were not adjusted for age, which
is likely to be an important confounder in these analyses. Rah and col-
leagues in a study of myopia in parents and children have found that there
is an association between near work and myopia, but speculated that the
actual strength of the association was probably imprecise because of the
inaccuracy of measures of near work. They suggest that better methods of
reporting near work activities are needed for future myopia research in
children.
31
A relationship between near work activity and myopic change in refrac-
tive error has been found in adults. Microscopists have been shown to have
higher prevalence of myopia than the general population and higher
prevalence of adult progression of myopia, but a comparison group was
lacking in this report.
32
Studies of other specific exposure groups, e.g.
medical students,
14
suggest that these persons have greater prevalence of
myopia than other similarly aged groups. Wu et al. reported that adults
who reported near work activities were more likely to be myopic as com-
pared with others in the population.
16
Few studies in adults have had care-
ful, precise measures of near work and therefore it is yet to be established
whether near work activity is the important exposure and not just a con-
founder of other important possible causes.
Education/Income
Education and income are considered together because it is usually not
possible to separate the effects of these two exposures. The association of
more myopic refractive error with level of educational achievement (and
usually with income as well) in children and adults has been found in most
11 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 11
studies of refraction.
9,12,15,18,33,34
It is thought that this reflects near work
activities, although there is a dearth of studies that assess the relationship
quantitatively and by specific activity as noted above. The education/
refraction association relation may reflect common genetic determinants
of intelligence (or educational achievement) and refraction.
35
It is note-
worthy that education was not associated with change in refraction in two
large epidemiologic studies of adults.
36,37
Outdoor activity
Ip et al. reported a small effect of hours spent outdoors on refraction (more
hyperopic) in children in the Sydney Myopia Study.
9
This finding was
extended by Rose and colleagues, who reported on refraction in a sample of
6- and 12-year-old school children in Sydney, Australia. They found an
inverse association of total time outdoors with refraction after adjusting for
near work, parental myopia, and ethnicity.
38
Hours spent playing sports was
inversely associated with myopia in a study of 1777 students aged 12- to
17-years old in Amman, Jordan, but these data were not adjusted for age.
39
Jones and colleagues reported that lower amounts of sports and out-
door activities increased the odds of children, with two myopic parents,
becoming myopic.
40
The chances of children with no myopic parents
becoming myopic was the lowest in the children with the greatest amount
of sports and outdoor activities. Higher levels of total time spent outdoors,
rather than sports per se, were associated with less myopia after adjustment
is made for near work, parental myopia, and ethnicity. Rose and colleagues
reported that Australian 6- to 7-year-olds spent more hours in outdoor
activities than Singaporean children of the same age, the latter having a
higher prevalence of myopia.
41
Jacobsen and colleagues reported an appar-
ent protective effect of physical activity for development of myopia over a
two-year interval in a group of medical students in Copenhagen.
42
There is no data to suggest that physical activity or sports has any effect
on refraction or change in refraction in adults.
Age
In childhood, increasing age is associated with increasing prevalence of
myopia.
43,44
In adults, increasing age is associated with a hyperopic shift
36
unless cataract is present when there may then be increasing myopia.
45,46
The age effect is further described in the section on “Review of Studies.”
12 B.E.K. Klein
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 12
Race/Ethnicity
The comparisons that have been described are based on published data
from many different studies and so comparison between the groups
described is usually not based on uniform criteria for inclusion, nor are
the methods of refraction identical. Nevertheless, the generalizations
about the differences between the racial/ethnic groups are correct. Adult
Chinese in Singapore have a higher prevalence of myopia than similarly
aged European-derived populations
34
; Mongolians have a lower preva-
lence of myopia than the Chinese in Singapore and Taiwan and similar
prevalences to populations of largely European background
47
; Eskimos
have a lower prevalence of myopia than Whites, Blacks and Chinese
48
; and
Barbadians have higher prevalences of hyperopia and myopia than
European-derived populations.
16,37
For the last study, the authors suggest
that this may be due to higher prevalences of cataract, glaucoma and other
ocular conditions in Barbadians.
Nuclear cataract
Nuclear cataract has been found to be associated with myopia in many
studies
11,36,46,49,50
(Table 2). This is thought to reflect the increased power of
the more sclerotic lens and not a reflection of increased axial length.
Family aggregation/Genetics
This section will briefly address the genetic epidemiologic evidence to sup-
port the notion that myopia has both environmental and genetic determi-
nants. Study designs include population-based and traditional pedigree
studies. The primary question involves determining how much of the
clustering of myopia in the families reflects common exposures and how
much is due to hereditary factors. The section starts with studies based on
phenotype and then a few studies that examine genes or genetic markers
are briefly described.
Siblings
The presence of myopia in a sibling was associated with increased odds of
myopia in school children in Amman, Jordan.
39
In the Framingham
Offspring Eye Study, the odds of the subjects having myopia was significantly
13 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 13
increased when a sibling was myopic (OR varied from 2.50 to 5.13,
depending upon the age difference of the siblings).
51
In the adult population participating in the Beaver Dam Eye Study, Lee
and colleagues reported a sibling correlation of a refractive error of 0.37
(1418 sibling pairs).
46
There was no correlation of refraction between
spouse pairs. The odds ratios for myopia were similar to those for sister-
sister, sister-brother and brother-brother pairs, being 4.64, 4.53, and 3.36,
respectively. These data in adults suggest strong familial effects on refrac-
tion, and, although the relative importance of environment and genetics
were not partitioned, the findings are compatible with the existence of
important genetic determinants of refraction across its range.
In data from the Salisbury Eye Evaluation Study that included 274 older
adult sibships, Wojciechowski and colleagues found an OR of 2.65 (95%
CI: 1.67-4.19) for myopia threshold of −0.050; neither gender nor race
(black or white) had a significant effect on this relationship.
48
Eskimo fam-
ilies showed correlations between sibs but not between parents and chil-
dren, suggesting environmental effects; there was virtually no myopia in
grandparents or parents but 58% of children were myopic.
52
Parent-child
In a case-control study of myopia in 1853 school children in Oman, the
presence of myopia in parents was associated with myopia in the chil-
dren.
53
In the study in Jordanian school children, the odds of a child being
myopic increased with the number of myopic parents.
39
Saw and her colleagues found that the progression of myopia in chil-
dren was greater for those children whose parents were myopic.
54
This
finding was also reported by Lam and colleagues who examined the effects
of parental myopia on myopia (n = 7560) and myopic shift (n = 2628) over
one year in their children.
55
Children with a greater number of myopic par-
ents were more myopic and had a greater average myopic shift. Analyses
were adjusted for age, gender, parental education and near work per-
formed by the child.
Other family members
Klein and colleagues evaluated the possibility of a familial effect on refrac-
tion for several different sorts of family relationships (sibs, parents and
children, avunculars and cousins).
56
She found stronger correlations
14 B.E.K. Klein
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 14
between sibling and cousin pairs than between parents and children and
avuncular pairs. Segregation analysis did not support the involvement of a
single major locus across the range of refractive error but models allowing
for polygenic effects provided a better fit. This suggests that several genes
of modest effect may influence refraction, possibly in conjunction with
environmental factors.
Genetics
High myopia, sometimes associated with other anomalies, has been asso-
ciated with several genes.
57–60
Some of the regions associated with high
myopia have been mapped to chromosomes 18p11.3 (MYP2),
61
12q21 to
23 (MYP3),
62
17q21 to 22 (MYP5)
63
and to other sites.
57,59,62–68
Moderate
myopia has been mapped to 22q13
69
and 8p23.
70,71
Simpson and colleagues examined the association of PAX 6 and SOX2
with refraction in a British cohort.
72
They found no relationship of these
genes to myopia or other spherical refractions, although Hewitt and
colleagues
60
and Tsai and colleagues
73
did find associations with severe
myopia. Hammond and his colleagues reported a susceptibility locus for
myopia in the PAX6 gene region in their study of twins.
70
In contrast,
Schache and colleagues did not report linkage to this site in their study of
233 adult dizygotic Australian twin pairs.
64
It is possible that the twins in
this study are in some way selectively different from the twins in
Hammond’s study. Such lack of consistency is not uncommon in genetic
studies of complex traits. Klein and colleagues found evidence of linkage
of refraction to regions on 22q, previously linked to myopia, and also to
novel regions on 1q and 7p.
74
These authors interpret their data to confirm
the notion that refraction is a complex trait likely influenced by several
genetic (and environmental/behavioral) exposures.
This brief review of genetic studies of myopia is not meant to be
comprehensive nor orderly, but to illustrate the importance of having
large enough samples of cases to meaningfully address the potential
importance of genes of modest effects that are likely to interact with
other genetic and environmental factors to influence the phenotype.
Furthermore, epidemiologic studies are essential to address these relation-
ships in general populations as opposed to ascertained groups and twins.
These goals are unlikely to be achieved by any one group of investigators;
they require judicious and thoughtful harmonizing of phenotype defini-
tions, appropriate stratification, uniform genotyping, and a consistent
15 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 15
approach to data analysis. Replication of findings in other groups is
essential to validate findings.
Comments
I have summarized some of the information about the epidemiology of
myopia that has appeared in the recent literature. In addition, I have
reviewed some of the risk factor data. To “prove” some etiologic and thera-
peutic hypotheses, randomized controlled clinical trials often provide the
best evidence of causal relationships. However, for most questions relating
to causes and treatments for myopia, clinical trials cannot be performed. For
example, it is unethical and not feasible to randomly assign near work for a
period of time in order to determine causal effects of this risk factor.
Treatment with drugs to modify accommodative mechanisms has proven to
be of limited effect and may not be long-lasting. Treatment with optical
approaches has also been of limited success.
75
Thus, we must rely largely on
well planned and executed epidemiologic (and genetic) studies to enlighten
us about the development and course of myopia and other refractive errors,
and to search for preventive measures that might alter the refractive status
of persons “at risk.”
Acknowledgments
The National Institutes of Health grant EY06594 and, in part, the Research to
Prevent Blindness (Senior Scientific Investigator Awards), New York, NY, pro-
vided funding for the entire study, including collection and analyses of data.
The author thanks Mary Kay Aprison for technical support.
References
1. Kempen JH, Mitchell P, Lee KE, et al. (2004) The prevalence of refractive
errors among adults in the United States, Western Europe, and Australia. Arch
Ophthalmol 122: 495–505.
2. National Eye Advisory Council (US). (1983) Vision research a national plan
1983–87. U.S. Department of Health and Human Services. NIH Publication
No. 83–2469. Bethesda, MD.
16 B.E.K. Klein
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 16
3. Javitt JC, Chiang YP. (1994) The socioeconomic aspects of laser refractive
surgery. Arch Ophthalmol 112: 1526–1530.
4. Mutti DO, Zadnik K, Adams AJ. (1996) Myopia. The nature versus nurture
debate goes on. Invest Ophthalmol Vis Sci 37: 952–957.
5. Saw SM, Katz J, Schein OD, et al. (1996) Epidemiology of myopia. Epidemiol
Rev 18: 175–187.
6. Zadnik K, Mutti DO. (2006) In: Benjamin W (ed.), Incidence and Distribution
of Refractive Anomalies. Borish’s Clinical Refraction, 2nd ed., pp. 35–55.
Elsevier, St. Louis.
7. Goss DA, Grosvenor T. (1996) Reliability of refraction — a literature review.
J Am Optom Assoc 67: 619–630.
8. Ojaimi E, Rose KA, Morgan IG, et al. (2005) Distribution of ocular biometric
parameters and refraction in a population-based study of Australian children.
Invest Ophthalmol Vis Sci 46: 2748–2754.
9. Ip JM, Huynh SC, Kifley A, et al. (2007) Variation of the contribution from
axial length and other oculometric parameters to refraction by age and eth-
nicity. Invest Ophthalmol Vis Sci 48: 4846–4853.
10. Zadnik K, Manny RE, Yu JA, et al. (2003) Ocular component data in school-
children as a function of age and gender. Optom Vis Sci 80: 226–236.
11. Dandona R, Dandona L, Naduvilath TJ, et al. (1999) Refractive errors in an
urban population in Southern India: the Andhra Pradesh Eye Disease
Study. Invest Ophthalmol Vis Sci 40: 2810–2818.
12. Saw SM, Carkeet A, Chia KS, et al. (2002) Component dependent risk factors
for ocular parameters in Singapore Chinese children. Ophthalmology 109:
2065–2071.
13. Kinge B, Midelfart A. (1999) Refractive changes among Norwegian university
students — a three-year longitudinal study. Acta Ophthalmol Scand 77:
302–305.
14. Lin LL, Shih YF, Lee YC, et al. (1996) Changes in ocular refraction and its
components among medical students — a 5-year longitudinal study. Optom
Vis Sci 73: 495–498.
15. Wang Q, Klein BE, Klein R, Moss SE. (1994) Refractive status in the Beaver
Dam Eye Study. Invest Ophthalmol Vis Sci 35: 4344–4347.
16. Wu SY, Nemesure B, Leske MC. (1999) Refractive errors in a black adult
population: the Barbados Eye Study. Invest Ophthalmol Vis Sci 40: 2179–2184.
17. Wensor M, McCarty CA, Taylor HR. (1999) Prevalence and risk factors of
myopia in Victoria, Australia. Arch Ophthalmol 117: 658–663.
18. Attebo K, Ivers RQ, Mitchell P. (1999) Refractive errors in an older popula-
tion: The Blue Mountains Eye Study. Ophthalmology 106: 1066–1072.
19. Katz J, Tielsch JM, Sommer A. (1997) Prevalence and risk factors for refrac-
tive errors in an adult inner city population. Invest Ophthalmol Vis Sci 38:
334–340.
17 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 17
20. Shufelt C, Fraser-Bell S, Ying-Lai M, et al. (2005) Refractive error, ocular bio-
metry, and lens opalescence in an adult population: the Los Angeles Latino
Eye Study. Invest Ophthalmol Vis Sci 46: 4450–4460.
21. Thorn F, Gwiazda J, Held R. (2005) Myopia progression is specified by a dou-
ble exponential growth function. Optom Vis Sci 82: 286–297.
22. Dong L, Gwiazda J, Hyman L, et al., COMET Group. (2007) Myopia stabiliza-
tion in the Correction of Myopia Evaluation Trial (COMET) cohort. Invest
Ophthalmol Vis Sci 48: 2385.
23. Ellingsen KL, Nizam A, Ellingsen BA, Lynn MJ. (1997) Age-related refractive
shifts in simple myopia. J Refract Surg 13: 223–228.
24. Mutti DO, Zadnik K. (2000) Age-related decreases in the prevalence of myopia:
longitudinal change or cohort effect? Invest Ophthalmol Vis Sci 41: 2103–2107.
25. Bengtsson B, Grodum K. (1999) Refractive changes in the elderly. Acta
Ophthalmol Scand 77: 37–39.
26. Lee KE, Klein BE, Klein R, Wong TY. (2002) Changes in refraction over
10 years in an adult population: the Beaver Dam Eye Study. Invest Ophthalmol
Vis Sci 43: 2566–2571.
27. Wong L, Coggon D, Cruddas M, Hwang CH. (1993) Education, reading, and
familial tendency as risk factors for myopia in Hong Kong fishermen.
J Epidemiol Community Health 47: 50–53.
28. Hepsen IF, Evereklioglu C, Bayramlar H. (2001) The effect of reading and
near-work on the development of myopia in emmetropic boys: a prospective,
controlled, three-year follow-up study. Vision Res 41: 2511–2520.
29. Rose KA, Morgan IG, Smith W, et al. (2008) Myopia, lifestyle, and schooling
in students of Chinese Ethnicity in Singapore and Sydney. Arch Ophthalmol
126: 527–530.
30. Mallen EA, Gammoh Y, Al Bdour M, Sayegh FN. (2005) Refractive error and
ocular biometry in Jordanian adults. Ophthalmic Physiol Opt 25: 302–309.
31. Rah MJ, Mitchell GL, Mutti DO, Zadnik K. (2002) Levels of agreement
between parents’ and children’s reports of near work. Ophthalmic Epidemiol
9: 191–203.
32. Adams DW, McBrien NA. (1992) Prevalence of myopia and myopic progres-
sion in a population of clinical microscopists. Optom Vis Sci 69: 467–473.
33. Wong TY, Foster PJ, Johnson GJ, Seah SK. (2002) Education, socioeconomic
status, and ocular dimensions in Chinese adults: the Tanjong Pagar Survey.
Br J Ophthalmol 86: 963–968.
34. Wong TY, Foster PJ, Hee J, et al. (2000) Prevalence and risk factors for refrac-
tive errors in adult Chinese in Singapore. Invest Ophthalmol Vis Sci 41:
2486–2494.
35. Dirani M, Shekar SN, Baird PN. (2008) The role of educational attainment in
refraction: the Genes in Myopia (GEM) twin study. Invest Ophthalmol Vis Sci
49: 534–538.
18 B.E.K. Klein
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 18
36. Lee KE, Klein BE, Klein R. (1999) Changes in refractive error over a 5-year
interval in the Beaver Dam Eye Study. Invest Ophthalmol Vis Sci 40:
1645–1649.
37. Wu SY, Yoo YJ, Nemesure B, et al. (2005) Nine-year refractive changes in the
Barbados Eye Studies. Invest Ophthalmol Vis Sci 46: 4032–4039.
38. Rose KA, Morgan IG, Ip J, et al. (2008) Outdoor activity reduces the preva-
lence of myopia in children. Ophthalmology 115: 1279–1285.
39. Khader YS, Batayha WQ, Abdul-Aziz SM, Shiekh-Khalil MI. (2006)
Prevalence and risk indicators of myopia among schoolchildren in Amman,
Jordan. East Mediterr Health J 12: 434–439.
40. Jones LA, Sinnott LT, Mutti DO, et al. (2007) Parental history of myopia,
sports and outdoor activities, and future myopia. Invest Ophthalmol Vis Sci 48:
3524–3532.
41. Rose KA, Morgan IG, Smith W, et al. (2008) Myopia, lifestyle, and schooling
in students of Chinese ethnicity in Singapore and Sydney. Arch Ophthalmol
126: 527–530.
42. Jacobsen N, Jensen H, Goldschmidt E. (2008) Does the level of physical
activity in university students influence development and progression of
myopia? — a 2-year prospective cohort study. Invest Ophthalmol Vis Sci 49:
1322–1327.
43. Saw SM, Chua WH, Hong CY, et al. (2002) Height and its relationship to
refraction and biometry parameters in Singapore Chinese children. Invest
Ophthalmol Vis Sci 43: 1408–1413.
44. Matsumura H, Hirai H. (1999) Prevalence of myopia and refractive changes
in students from 3 to 17 years of age. Surv Ophthalmol 44(1): S109–S115.
45. Guzowski M, Wang JJ, Rochtchina E, et al. (2003) Five-year refractive changes
in an older population: the Blue Mountains Eye Study. Ophthalmology 110:
1364–1370.
46. Lee KE, Klein BE, Klein R, Fine JP. (2001) Aggregation of refractive error and
5-year changes in refractive error among families in the Beaver Dam Eye
Study. Arch Ophthalmol 119: 1679–1685.
47. Wickremasinghe S, Foster PJ, Uranchimeg D, et al. (2004) Ocular
biometry and refraction in Mongolian adults. Invest Ophthalmol Vis Sci 45:
776–783.
48. Wojciechowski R, Congdon N, Bowie H, et al. (2005) Heritability of refractive
error and familial aggregation of myopia in an elderly American population.
Invest Ophthalmol Vis Sci 46: 1588–1592.
49. Brown NA, Hill AR. (1987) Cataract: the relation between myopia and
cataract morphology. Br J Ophthalmol 71: 405–414.
50. Kubo E, Kumamoto Y, Tsuzuki S, Akagi Y. (2006) Axial length, myopia, and
the severity of lens opacity at the time of cataract surgery. Arch Ophthalmol
124: 1586–1590.
19 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 19
51. The Framingham Offspring Eye Study Group. (1996) Familial aggregation
and prevalence of myopia in the Framingham Offspring Eye Study. The
Framingham Offspring Eye Study Group. Arch Ophthalmol 114: 326–332.
52. Young FA, Leary GA, Baldwin WR, et al. (1969) The transmission of refractive
errors within eskimo families. Am J Optom Arch Am Acad Optom 46: 676–685.
53. Khandekar R, Al Harby S, Mohammed AJ. (2005) Determinants of myopia
among Omani school children: a case-control study. Ophthalmic Epidemiol
12: 207–213.
54. Saw SM, Nieto FJ, Katz J, et al. (2001) Familial clustering and myopia pro-
gression in Singapore school children. Ophthalmic Epidemiol 8: 227–236.
55. Lam DS, Fan DS, Lam RF, et al. (2008) The effect of parental history of
myopia on children’s eye size and growth: results of a longitudinal study.
Invest Ophthalmol Vis Sci 49: 873–876.
56. Klein AP, Duggal P, Lee KE, et al. (2005) Support for polygenic influences on
ocular refractive error. Invest Ophthalmol Vis Sci 46: 442–446.
57. Tang WC, Yip SP, Lo KK, et al. (2007) Linkage and association of myocilin
(MYOC) polymorphisms with high myopia in a Chinese population. Mol Vis
13: 534–544.
58. Zhang Q, Li S, Xiao X, et al. (2007) Confirmation of a genetic locus for
X-linked recessive high myopia outside MYP1. J Hum Genet 52: 469–472.
59. Nallasamy S, Paluru PC, Devoto M, et al. (2007) Genetic linkage study of
high-grade myopia in a Hutterite population from South Dakota. Mol Vis 13:
229–236.
60. Hewitt AW, Kearns LS, Jamieson RV, et al. (2007) PAX6 mutations may be
associated with high myopia. Ophthalmic Genet 28: 179–182.
61. Young RR. (1998) Diagnosis and medical management of multiple sclerosis.
J Spinal Cord Med 21: 109–112.
62. Young TL, Ronan SM, Alvear AB, et al. (1998) A second locus for familial high
myopia maps to chromosome 12q. Am J Hum Genet 63: 1419–1424.
63. Paluru P, Ronan SM, Heon E, et al. (2003) New locus for autosomal dominant
high myopia maps to the long arm of chromosome 17. Invest Ophthalmol Vis
Sci 44: 1830–1836.
64. Schache M, Richardson AJ, Pertile KK, et al. (2007) Genetic mapping of
myopia susceptibility loci. Invest Ophthalmol Vis Sci 48: 4924–4929.
65. Paluru PC, Nallasamy S, Devoto M, et al. (2005) Identification of a novel locus
on 2q for autosomal dominant high-grade myopia. Invest Ophthalmol Vis Sci
46: 2300–2307.
66. Naiglin L, Gazagne C, Dallongeville F, et al. (2002) A genome wide scan for
familial high myopia suggests a novel locus on chromosome 7q36. J Med
Genet 39: 118–124.
67. Zhang Q, Guo X, Xiao X, et al. (2005) A new locus for autosomal dominant high
myopia maps to 4q22-q27 between D4S1578 and D4S1612. Mol Vis 11: 554–560.
20 B.E.K. Klein
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 20
68. Zhang Q, Guo X, Xiao X, et al. (2006) Novel locus for X linked recessive high
myopia maps to Xq23-q25 but outside MYP1. J Med Genet 43: e20.
69. Stambolian D, Ibay G, Reider L, et al. (2004) Genomewide linkage scan for
myopia susceptibility loci among Ashkenazi Jewish families shows evidence of
linkage on chromosome 22q12. Am J Hum Genet 75: 448–459.
70. Hammond CJ, Andrew T, Mak YT, Spector TD. (2004) A susceptibility locus for
myopia in the normal population is linked to the PAX6 gene region on chromo-
some 11: a genomewide scan of dizygotic twins. Am J Hum Genet 75: 294–304.
71. Stambolian D, Ciner EB, Reider LC, et al. (2005) Genome-wide scan for
myopia in the Old Order Amish. Am J Ophthalmol 140: 469–476.
72. Simpson CL, Hysi P, Bhattacharya SS, et al. (2007) The Roles of PAX6 and
SOX2 in Myopia: lessons from the 1958 British Birth Cohort. Invest
Ophthalmol Vis Sci 48: 4421–4425.
73. Tsai YY, Chiang CC, Lin HJ, et al. (2007) A PAX6 gene polymorphism is asso-
ciated with genetic predisposition to extreme myopia. Eye 22: 576–581.
74. Klein AP, Duggal P, Lee KE, et al. (2007) Confirmation of linkage to ocular
refraction on chromosome 22q and identification of a novel linkage region on
1q. Arch Ophthalmol 125: 80–85.
75. Gwiazda JE, Hyman L, Norton TT, et al. (2004) Accommodation and related
risk factors associated with myopia progression and their interaction with
treatment in COMET children. Invest Ophthalmol Vis Sci 45: 2143–2151.
76. Ojaimi E, Morgan IG, Robaei D, et al. (2005) Effect of stature and other
anthropometric parameters on eye size and refraction in a population-based
study of Australian children. Invest Ophthalmol Vis Sci 46: 4424–4429.
77. Fan DS, Lam DS, Lam RF, et al. (2004) Prevalence, incidence, and progression
of myopia of school children in Hong Kong. Invest Ophthalmol Vis Sci 45:
1071–1075.
78. Grosvenor T, Skeates PD. (1999) Is there a hyperopic shift in myopic eyes
during the presbyopic years? Clin Exp Optom 82: 236–243.
79. Cortinez MF, Chiappe JP, Iribarren R. (2008) Prevalence of refractive errors
in a population of office-workers in Buenos Aires, Argentina. Ophthalmic
Epidemiol 15: 10–16.
80. Lim R, Mitchell P, Cumming RG. (1999) Refractive associations with cataract:
the Blue Mountains Eye Study. Invest Ophthalmol Vis Sci 40: 3021–3026.
81. Gudmundsdottir E, Arnarsson A, Jonasson F. (2005) Five-year refractive
changes in an adult population: Reykjavik Eye Study. Ophthalmology 112:
672–677.
21 Epidemiology of Myopia
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 21
b846_Chapter-1.1.qxd 4/8/2010 1:54 AM Page 22
This page intentionally left blank This page intentionally left blank
Environmental Risk Factors for
Myopia in Children
Wilson C.J. Low*, Tien-Yin Wong*
,†,‡,§
and Seang-Mei Saw*
,‡
Introduction
In Caucasian populations, approximately 20% to 25% of individuals
develop myopia.
1
In contrast, the prevalence of myopia is much higher,
reaching epidemic levels of up to 80% in selected regions of Asian coun-
tries, such as Taiwan, Hong Kong, and Singapore.
2–4
Myopia is a major
public health problem because of under-correction and undiagnosed
cases, which can lead to visual impairments and potentially blinding
ocular complications.
5
Myopia also poses a direct economic burden
resulting from the cost of refractive correction through repeat optome-
try visits and prescription of eyeglasses, contact lenses, and refractive
surgery.
6
In Singapore, the mean annual direct cost of myopia for each
schoolchild aged 7 to 9 years is US$148.
7
Myopia is a complex eye dis-
ease, in which both genetic and environmental factors contribute to its
development.
8
Twin heritability, familial aggregation, pedigree segrega-
tion, and linkage studies provide evidence to support a major genetic
component influencing myopic development.
9–12
Additionally, environ-
mental factors such as near work and outdoor activities appear to also
play an important role in the development of myopia.
13–15
This chapter
aims to provide a summary of the known as well as controversial
risk factors for myopia and ocular biometry in children, including family
23
1.2
*Department of Epidemiology and Public Health, Yong Loo Lin School of Medicine, National
University of Singapore, Singapore. E-mail: [email protected]

Centre for Eye Research Australia, University of Melbourne, Australia.

Singapore Eye Research Institute, Singapore.
§
Department of Ophthalmology, Yong Loo Lin School of Medicine, National University of Singapore,
Singapore.
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 23
history, near work, outdoor and stature, birth parameters, smoking, and
breastfeeding.
Definition of Myopia in Epidemiologic Studies
Refractive error is commonly quantified as spherical equivalent (SE)
(sphere + half negative cylinder) in diopters (D) on a continuous scale.
Most commonly used and acknowledged definitions of myopia in epi-
demiologic studies include SE of at least –0.5 D, –0.75 D, and –1.0 D.
16
The
Refractive Error Study in Children (RESC) used the definition of myopia
as SE of at least –0.5 D.
17
Other definitions include moderate myopia
defined as SE of at least –3.0 D, while high myopia is denoted as SE as least
–6.0 D, –8.0 D, and –10.0 D respectively. It should be noted that the cutoff
values for myopia are arbitrary and serve to dichotomize the presence of
myopia, i.e. myopia present or not present. However, setting an arbitrary
cutoff of a physiologic range limits the comparison of studies using dis-
similar criteria and disregards the elongation of the axial length (AL). To
date, there is no universal accepted definition of myopia.
Risk Factors for Myopia and Ocular Biometry
Family history of myopia
In a population-based cross-sectional study of 2353 Sydney schoolchild-
ren (60% European Caucasian and 15% East Asian) aged 12 years who
participated in the Sydney Myopia Study (SMS), children with one and
two myopic parents had about two and eight times higher risk respectively
(OR = 2.3; 95% confidence interval (CI) = 1.8–2.9 and OR = 7.9; 95% CI =
5–12.4, respectively) of developing myopia (defined as SE at least –0.5 D)
compared to those with no myopic parents, after adjusting for age, gender,
near work, outdoor activity, and ethnicity (Table 1).
18
The level of parental
myopia followed a dose-response relationship with children’s myopia
onset; increasing severity of parental myopia conferred a greater risk of
myopia. The OR for mild myopia (defined as SE from –3 to –0.5 D), mod-
erate myopia (defined as SE at least –6 to –3 D), and high myopia (defined
as SE at least –6 D) was 6.4 (95% CI = 1.5–27.8), 10.2 (95% CI = 2.6–40.1),
24 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 24
and 21.8 (95% CI = 5.3–89.4) respectively. However, in SMS, the AL of
premyopic eyes did not associate with parental myopia (defined as SE ≤
–0.75D in this analysis).
In a landmark study coordinated by Zadnik and co-workers, (the Orinda
Longitudinal Study of Myopia (OLSM) on 716 predominantly Caucasian
children aged 6 to 14 years), she demonstrated that the premyopic eyes
in children with myopic parents had a longer AL than those without
myopic parents, suggesting that the size of the premyopic eyes was already
influenced by parental myopia status (Table 1).
19
Moreover, she found that
children with two myopic parents developed myopia more often (11%)
than children with one myopic parent (5%) or children without myopic
parents (2%). Myopia was defined as SE at least –0.75 D in this analysis.
In a cross-sectional analysis of 1453 Singapore Chinese schoolchildren
aged seven to nine years from the Singapore Cohort Study on the Risk fac-
tors for Myopia (SCORM), having one myopic parent increased the AL by
0.14 mm (95% CI = 0.00034–0.25), and two myopic parents increased the
AL by 0.32 mm (95% CI = 0.02–0.03) compared with no myopic parent
after adjusting for age, gender, books read per week, school, and height
(Table 1).
20
Similarly, after controlling for the same confounders, having
one myopic parent lowered the SE by 0.39 D (95% CI = –0.59– –0.18), and
one myopic parents reduced the SE by 0.74 D (95% CI = –0.97– –0.51).
The odds ratio of myopia for children with two myopic parents compared
with those with one myopic parent was 1.53 (95% CI = 1.16–2.01).
There were other studies that showed the association of family history
of myopia with myopia in children, but these studies suffered from
methodological limitations such as small sample size, inappropriate sam-
pling strategies, lack of cycloplegic refraction, and lack of control for
major confounders.
10,21–27
For example, a school-based cross-sectional
analysis of 7560 Chinese children aged 5 to 16 years from Hong Kong
showed that the number of myopic parents was associated with SE, vitre-
ous chamber depth, and AL in all children (both myopic and non-myopic
children) (Table 1).
27
However, this Hong Kong study suffered from
sampling problems as only selected schools were sampled.
Nevertheless, a previous study demonstrated no significant association
of family history with myopia in children.
28
In Hong Kong, Fan and co-
workers studied 514 Chinese children aged between two and six years but
did not find an association of parental myopia status with more myopic
refractive error and longer AL (Table 1).
28
However, this study is limited by
25 Environmental Risk Factors for Myopia in Children
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 25
2
6
W
.
C
.
J
.

L
o
w
,

T
.
Y
.

W
o
n
g

a
n
d

S
.
-
M
.

S
a
w
Table 1. Summary of Family History as Risk Factor for Myopia and Ocular Biometry
Age Definition of Association Association Association
Location/Study Study Design N Cycloplegic (Years) Myopia (SE) with SE with AL with Myopia
Sydney Myopia Population-based, 2353 Yes 11.1–12.7 ≤–0.5 D + + +
Study
18
cross-sectional
Orinda Cross-sectional 716 Yes 6–14 ≤–0.75 D + + +
Longitudinal
Study of
Myopia
19
Singapore Cohort Cross-sectional 1453 Yes 7–9 ≤–0.5 D + + +
Study on Risk
Factors of
Myopia
20
Hong Kong
27
School-based, 7560 Yes 5–16 ≤–0.5 D + +
cross-sectional
Hong Kong
28
School-based, 514 Yes 2.3–6.4 Not given 0 0
cross-sectional
AL: Axial length, D: Diopters, SE: Spherical equivalent, +: Association found, 0: Association evaluated but not found.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

2
6
the school-based design since the schools recruited may not be represen-
tative of the general population.
Near work
In a population-based cross-sectional study on schoolchildren recruited in
the SMS (n = 2339 and aged 11.1 to 14.4 years), near work parameters were
associated with myopia after adjusting for age, sex, ethnicity, school type,
parental myopia, and outdoor activity (Table 2).
29
Specifically, children
who read continuously for more than 30 minutes were 1.5-fold (OR = 1.5;
95% CI = 1.05–2.1) more likely to develop myopia when compared to
those who read less than 30 minutes continuously. Likewise, children who
performed close reading distance of less than 30 cm were 2.5 times (OR =
2.5; 95% CI = 1.7–4.0) more likely to have myopia than those who per-
formed more than this distance. Similarly, children who spent longer time
reading for pleasure and read close at less than 30 cm were more likely to
be associated with more myopic SE, after adjusting for age, sex, ethnicity,
and school type (p trend = 0.02 and p = 0.0003).
One thousand and five Singaporean children aged seven to nine years
were cross-sectionally analyzed in the SCORM; 72.5%, 19.4%, 5.6%, and
2.5% were Chinese, Malays, Indians, and children of other races respec-
tively (Table 2).
13
Saw found that children who read more than two books
per week were about three times more likely (OR = 3.05; 95% CI =
1.80–5.18) to have higher myopia (defined as SE at least –3.0 D) compared
to those who read less than two books per week, after controlling for age,
gender, race, night light, parental myopia, and school. Reading more than
two hours per day gave a 1.5 times greater odds (OR = 1.50; 95% CI =
0.87–2.55) of having higher myopia compared to those who read less than
this amount, but this was not significant. For every book read per week,
the AL elongated by 0.04 mm after adjusting for the same covariates. There
was a statistically significant interaction effect of parental history of
myopia and books read per week on SE (P < 0.001). For example, children
with two myopic parents and who read more than two books per week had
an age-gender-race adjusted mean SE of –1.33 D, while children with no
myopic parents and who read two or fewer books per week had an
adjusted mean SE of –0.19 D. A similar effect was found on AL; mean AL
of 23.78 mm when the children had two myopic parents and who read
more than two books per week vs. mean AL of 23.2 mm in children with
no myopic parents and who read fewer than two books per week.
27 Environmental Risk Factors for Myopia in Children
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 27
2
8
W
.
C
.
J
.

L
o
w
,

T
.
Y
.

W
o
n
g

a
n
d

S
.
-
M
.

S
a
w
Table 2. Summary of Near Work as Risk factor for Myopia and Ocular Biometry
Age Definition of Association Association Association
Location/Study Study Design N Cycloplegic (Years) Myopia (SE) with SE with AL with Myopia
Sydney Myopia Population-based, 2339 Yes 11.1–14.4 ≤–0.5 D + +
Study
29
cross-sectional
Singapore Cohort Cross-sectional 1005 Yes 7–9 ≤–0.5 D + ++
Study on Risk
Factors for
Myopia
13
Orinda Cross-sectional 366 Yes Mean: ≤–0.75 D +
Longitudinal 13.7 ± 0.5
Study of
Myopia
24
Xichang Pediatric School-based, 998 Yes 13–17 ≤–0.5 D 0 0
Refractive cross-sectional
Error Study
36
Singapore
31
Cross-sectional 128 Yes 3–7 ≤–0.50 D 0
AL: Axial length, D: Diopters, SE: Spherical equivalent, +: Association found, ++: Association found with higher myopia (SE ≤ −3D), 0: Association evaluated
but not found.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

2
8
The OLSM looked at 366 eighth-grade predominantly Caucasian chil-
dren (mean age of 13.7 ± 0.5 years) and found that the OR of myopia
(defined as SE at least –0.75 D) was 1.02 (95% CI = 1.008–1.032) for every
diopter-hours spent per week, after controlling for parental myopia,
diopter-hours per week and achievement scores (Table 2).
24
However,
there was no interaction between parental myopia and near work
(p = 0.67). Children with myopia were more likely to have parents with
myopia.
Other studies suffered from methodological limitations such as small
sample size, inappropriate sampling strategies, lack of cycloplegic refrac-
tion, and lack of control for major confounders.
30–35
Near work was also shown to be not associated with myopia.
31,36
Lu and co-workers (Table 2)
36
analyzed 998 Chinese school children
aged 13 to 17 years from the Xichang Pediatric Refractive Error Study
(X-PRES) and reported the multivariate adjusted OR of myopia (defined
as SE at least –0.5 D) was 1.27 (95% CI = 0.75–2.14) for reading in hours
per week and SE was not associated with near work. However, the study
subjects may not be representative of the general population since this
was a school-based design. In another study, Saw and co-workers
recruited 128 children from one kindergarten in Singapore (Table 2).
31
The cross-sectional study found that after adjusting for parental history
of myopia and age, the OR of myopia was 1.0 (95% CI = 0.8–1.3) for
close-up work activity. However, this finding could be due to the small
sample size.
Outdoor activity
There were few prior studies that analyzed outdoor activity as a major
environmental factor for myopia.
14,15,23,36,37
Jones and co-workers (Table 3)
23
conducted a longitudinal study of
children in the OLSM in California. 514 children in the third to eighth
grade (aged 8 to 13 years) were included. Children who became myopic
(defined as SE at least –0.75 D) by the eighth grade were found to perform
less sports and outdoor activity (hours per week) at the third grade com-
pared to those who did not become myopic (7.98 ± 6.54 hours vs. 11.65 ±
6.97 hours). In predictive models for future myopia, combined amount of
sports and outdoor hours per week conferred a protective effect against
future myopia (OR = 0.91; 95% CI = 0.87–0.95) after adjusting for
parental myopia, reading hours, and sports and outdoor hours. Significant
29 Environmental Risk Factors for Myopia in Children
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 29
3
0
W
.
C
.
J
.

L
o
w
,

T
.
Y
.

W
o
n
g

a
n
d

S
.
-
M
.

S
a
w
Table 3. Summary of Outdoor Activity as Risk Factor for Myopia and Ocular Biometry
Age Definition of Association Association Association
Location/Study Study Design N Cycloplegic (Years) Myopia (SE) with SE with AL with Myopia
Orinda Longitudinal 514 Yes 8–13 ≤–0.75 D +
Longitudinal
Study
of Myopia
23
Sydney Myopia Population-based, 2367 Yes 11.1–14.4 ≤–0.5 D + +
Study
14
cross-sectional
Singapore
15
Cross-sectional 1249 Yes 11–20 ≤–0.5 D + + +
Denmark
37
Longitudinal 143 Yes Mean: 23 ≤–0.5 D + + +
Xichang School-based, 998 Yes 13–17 ≤–0.5 D 0
Pediatric cross-sectional
Refractive
Error Study
36
AL: Axial length, D: Diopters, SE: Spherical equivalent, +: Association found, 0: Association evaluated but not found.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

3
0
interaction was found between the number of parents with myopia and
hours of sports and outdoor activity on the development of myopia.
The SMS (Table 3)
14
analyzed 2367 school children aged 11 to 14 years
and found a higher level of outdoor activity (>2.8 hours per day) was
associated with more hyperopic mean SE refraction (0.54 D) after adjust-
ing for gender, ethnicity, parental myopia, near work activity, maternal and
paternal education. Furthermore, in an analysis combining amount of
outdoor activity and near work activity spent, children with low outdoor
and high near work had the (OR = 2.6; 95% CI = 1.2–6.0) higher odds for
myopia compared to those performing low near work and high outdoor
(reference group).
In Singapore, a cross-sectional analysis of SCORM was conducted to
analyze the effect of outdoor activity on myopia in 1249 teenagers aged 11
to 20 years (71.1%, Chinese, 20.7% Malays and 0.8% other ethnicities)
(Table 3).
15
After adjusting for age, gender, ethnicity, school, number of
books read per week, height, parental myopia, father’s education and IQ
level, outdoor activity was significantly negatively associated with myopia
(OR = 0.90; 95% CI = 0.84–0.96). For each hour increase in outdoor activ-
ity per day, the SE refraction increased by 0.17 D (95% CI = 0.10–0.25),
and the AL decreased by 0.06 mm (95% CI = −0.1 − −0.03), after adjust-
ing for the same confounders.
An analysis on a two-year longitudinal cohort study conducted in 143
Caucasian Danish medical students (mean age = 23 years) was performed
to investigate the level of physical activity on myopia.
37
The multiple
regression showed that time spent reading scientific literature was associ-
ated with a refractive change toward myopia (regression coefficient =
–0.063; 95% CI = –0.117– –0.008; p = 0.024), while the association was
inversed for the level of physical activity (regression coefficient = 0.175;
95% CI = 0.035–0.315; p = 0.015). Although the total amount of time
spent on outdoor activity was not recorded, the author postulated that the
level of physical activity could parallel that of outdoor activity and thus the
protective effect of physical activity on myopia could be attributed in part
to outdoor activity.
In the X-PRES, Lu and co-workers (Table 3)
36
initiated a school-based
cross-sectional study of 998 secondary school Chinese children aged 13 to
17 years from Xichang, China. After controlling for age, gender, parental
education, homework, reading and TV watching, outdoor activity was not
significantly associated with myopia (OR = 1.14; 95% CI = 0.69–1.89). The
students were administered a near-work survey to collect information on
31 Environmental Risk Factors for Myopia in Children
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 31
the time spent during the previous week on schoolwork, reading, watch-
ing television, video games and computer use, family business related
near-work tasks and outdoor activities. Nevertheless, the authors acknowl-
edged the lack of association between outdoor and myopia could be biased
by estimating near work and outdoor activities based on self-reported
questionnaires and by focusing on a single week rather than the children’s
long term experience. In addition, the interpretation of the findings was
possibly limited by the school-based design, high refusal (13%), and
incomplete near-work survey (19%).
Stature
In a cross-sectional study of 1449 Singapore Chinese schoolchildren aged
seven to nine years from the SCORM, Saw and co-workers (Table 4)
38
compared height in the first quartile and fourth quartile (adjusting for
age, gender, parental myopia, number of books per week, school, and
weight). The analysis showed that the AL was 0.46 mm longer. On the
other hand, the SE refraction was more negative by 0.47 D. In multiple
linear regression models for AL adjusting for the same factors, each cm
increase in height resulted in a 0.032 mm increase in AL (p < 0.001). For
each cm in height, the SE refraction decrease by 0.031 D (p = 0.002),
while for each kg increase in weight, the SE refraction decreased by
0.027 D (p = 0.01).
The SMS conducted a population-based cross-sectional analysis on
1765 six-year-old schoolchildren; 64.5% were Caucasians, 17.2% were East
Asians, and 18.3% belonged to other races (Table 4).
39
Children in the
first quintile for height had AL of 22.39 ± 0.04 mm compared with 22.76 ±
0.04 mm in children in the fifth quintile. After adjusting for age, gender,
parental myopia, weight, BMI, body fat percentage and waist circumfer-
ence, each 10 cm increase in height corresponded to a 0.29 mm (95% CI =
0.19–0.39) increase in AL. However, height was not significantly associated
with SE refraction.
A population-based cross-sectional study (the Tanjong Pagar survey
(TPS)) in Singapore analyzed data of 951 Chinese adults aged between 40
and 80 years, (Table 4)
40
and demonstrated that a 10 cm greater height was
associated with a longer AL of 0.23 mm (95% CI = 0.1–0.37), after adjust-
ing for age, gender, education, occupation, housing, income, and weight.
Adjusting for the same factors, for every 10 kg increase in weight, the SE
refraction increased by 0.22 D (95% CI = 0.05–0.39), and every 10 kg/m
2
32 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 32
3
3
E
n
v
i
r
o
n
m
e
n
t
a
l

R
i
s
k

F
a
c
t
o
r
s

f
o
r

M
y
o
p
i
a

i
n

C
h
i
l
d
r
e
n
Table 4. Summary of Stature as Risk Factor for Myopia and Ocular Biometry
Age Definition of Association Association
Location/Study Study Design N Cycloplegic (Years) Myopia (SE) with SE with AL
Singapore Cohort Cross-sectional 1449 Yes 7–9 ≤–0.5 D + +
Study on Risk
Factors for
Myopia
38
Sydney Myopia Population-based, 1765 Yes Mean: 6 ≤–0.5 D 0 +
Study
39
cross-sectional
Tanjong Pagar Population-based, 951 No 40–81 Not given ++ +
Survey
40
cross-sectional
AL: Axial length, D: Diopters, SE: Spherical equivalent, +: Association found, ++: Association found in weight and BMI but not height, 0: Association evalu-
ated but not found.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

3
3
BMI increased the SE refraction by 0.56 D (95% CI = 0.14–0.98). However,
height was not significantly associated with SE refraction.
Studies in other adult populations such as the Beaver Dam Eye
Study (BDES)
41
and the Reykjavik Eye Study (RES)
42
showed positive
associations between height and AL, while the Singapore Malay Eye
Study (SiMES) demonstrated that both height and weight were associated
with AL.
43
The Meiktila Eye Survey (MES) went so far to illustrate an
association between AL and height, weight and BMI.
44
The MES,
however, showed that SE refraction was positively associated with weight
and BMI.
Birth parameters
Few studies had elucidated the association of birth parameters and
myopia, SE refraction and ocular biometry, and it is still not clear if
birth parameters could influence myopia development in children.
45,46
The SMS conducted a population-based stratified random cluster
sample of six-year-old school students (n = 1765) of mean age 6.7 years
(range = 5.5–8.4 years) (Table 5)
45
and birth parameters were obtained
from the children’s hospital personal health records. After adjusting for
cluster, age, and gender, children with birth weight < 2500 g had a
shorter mean AL of 22.46 mm (95% CI = 22.20–22.72) compared with
a mean AL of 22.80 mm (CI = 22.70–22.90) for birth weight > 2500 g.
The multivariate analysis showed that birth length, but not birth weight,
was weakly associated with AL (Regression coefficient = 0.02 mm; 95%
CI = 0.00–0.03; p = 0.0472) after controlling for age, gender, birth
weight, birth length, head circumference, gestational age, and parental
myopia.
In Singapore, 1413 Singaporean Chinese children aged seven to nine
years with ocular data were included in an analysis on birth parameters
obtained from the SCORM (Table 5).
46
The study showed that children
with birth weights ≥ 4.0 kg had longer AL (adjusted mean 23.65 mm ver-
sus 23.16 mm), compared with children with birth weights <2.5 kg, after
adjusting for age, gender, school, height, parental myopia, and gestational
age. Multivariate analysis for AL showed that for each kg increase in birth
weight, each cm increase in birth head circumference, each cm increase in
birth length and each week increase in gestational age, the AL increased by
0.25 mm (p < 0.001), 0.05 mm (p = 0.004), 0.02 mm (p = 0.044), and
34 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 34
3
5
E
n
v
i
r
o
n
m
e
n
t
a
l

R
i
s
k

F
a
c
t
o
r
s

f
o
r

M
y
o
p
i
a

i
n

C
h
i
l
d
r
e
n
Table 5. Summary of Birth Parameters as Risk Factor for Myopia and Ocular Biometry
Age Definition of Association Association Association
Location/Study Study Design N Cycloplegic (Years) Myopia (SE) with SE with AL with Myopia
Sydney Myopia Population-based, 1765 Yes 5.5–8.4 0 +
Study
45
cross-sectional
Singapore Cross-sectional 1413 Yes 7–9 ≤–0.5 D 0 + 0
Cohort Study
on Risk
Factors for
Myopia
46
Genes in Cross-sectional 2448 Yes 18–86 ≤–0.5 D 0
Myopia
twin study
47
AL: Axial length, D: Diopters, SE: Spherical equivalent, +: Association found, 0: Association evaluated but not found.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

3
5
0.04 mm (p = 0.028) respectively. However, birth parameters (birth length,
weight, head circumference, and gestational age (ORs between 0.91–1.08))
were not significantly associated with myopia (defined as SE at least
–0.5 D) or high myopia (SE at least –3.0 D).
As far as the adult population was concerned, only one study conducted
by Dirani and co-workers (Table 5)
47
had attempted to investigate
the association between birth parameters and myopia (defined as SE at
least –0.5 D) in 1224 twins residing in Victoria, Australia, participating
in the Genes in Myopia (GEM) twin study. However, the multivariate
analysis showed no significant association between birth weight and
myopia (p = 0.26). The finding was difficult to interpret as birth weight
was self-reported rather than obtained from hospital records.
Smoking history
Smoking was recently identified as protective against myopia in three
studies; two were children studies
48,49
and one was an adult study.
50
Saw
and co-colleagues conducted a cross-sectional analysis of 1334 Chinese
school children aged seven to nine years from the SCORM (Table 6).
48
In this study, multivariate analysis adjusting for age, sex, school, parental
smoking status, and parent’s education demonstrated that for each year
of maternal smoking during the child’s lifetime, the SE refraction rose
by 0.15 D (95% CI = 0.041–0.25; p = 0.006). The number of years the
father smoked during the child’s lifetime was not significantly associated
with myopia (Regression coefficient = 0.008; 95% CI = –0.02–0.036;
p = 0.57). After controlling for age, sex, school, parental smoking status,
and parental education, for each year the mother smoked during the
child’s lifetime, the AL reduced by 0.07 mm (95% CI = –0.12–0.015;
p = 0.012). Conversely, the father smoking during the child’s lifetime had
no effect on AL (p = 0.96). After adjusting for age, sex, school, mother’s
education, and mother’s myopia, children with mothers who had
smoked during their lifetimes had more ‘‘positive’’ SE (adjusted mean
–0.28 D vs. –1.38 D) compared with children whose mothers did not
smoke (p = 0.012).
In an United States study, Stone and co-workers (Table 6)
49
analyzed
323 outpatients aged 1 to 20 years (mean age of 8.7 ± 4.4 years) from a
pediatric ophthalmology clinic at the Children’s Hospital of Philadelphia.
They found that if one or both parents had smoked, their children had a
36 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 36
3
7
E
n
v
i
r
o
n
m
e
n
t
a
l

R
i
s
k

F
a
c
t
o
r
s

f
o
r

M
y
o
p
i
a

i
n

C
h
i
l
d
r
e
n
Table 6. Summary of Parental Smoking as Risk factor for Myopia and Ocular Biometry
Age Definition of Association Association Association
Location/Study Study Design N Cycloplegic (Years) Myopia (SE) with SE with AL with Myopia
Singapore Cohort Cross-sectional 1334 Yes 7–9 ≤–0.5 D + +
Study on Risk
Factors for
Myopia
48
USA
49
Cross-sectional 323 Yes 1–20 ≤–0.5 D + +
Handan Population-based, 6491 No 30–99 ≤–0.5 D +
Eye Study
50
cross-sectional
AL: Axial length, D: Diopters, SE: Spherical equivalent, +: Association found.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

3
7
lower prevalence of myopia (12.4% vs. 25.4%; p = 0.004) and more
hyperopic mean SE refractions (1.83 ± 0.24 vs. 0.96 ± 0.27 D; p = 0.02)
than those whose parents never smoked. If one or more parents smoked
during pregnancy, their children had a lower prevalence of myopia (8.6%
vs. 23.9%; p = 0.003) and more hyperopic mean SE refractions (2.19 ± 0.34
vs. 1.07 ± 0.22 D; p = 0.006) than those whose parents never smoked.
Multivariate OR for myopia was 0.22 (95% CI = 0.07–0.64; p = 0.008)
when either parent currently smoked, 0.15 (95% CI = 0.04–0.53; p =
0.003) when one of the parents smoked during pregnancy, and 0.22
(95% CI = 0.08–0.59; p = 0.003) when either parent smoked during their
child’s lifetime, after adjusting for the child’s age, BMI, weighted near
work, parental myopia, and parental education.
In a population-based cross-sectional study of 6491 Chinese adults
aged 30 to 99 years from Handan, China, Liang and co-workers
(Table 6)
50
found that the multivariate OR for myopia was 0.7 (95% CI =
0.5–0.9; p = 0.003) in adults who currently smoked compared with
those who never smoked after controlling for age, history of diabetes,
smoking, hours of reading per day, and number of family members with
myopia.
Breastfeeding
In a population-based cross-sectional study of 2639 Chinese preschool
children aged 6 to 72 months from the Strabismus, Amblyopia and
Refractive Error Study (STARS) in Singapore, Sham and co-workers
(Table 7)
51
demonstrated that a history of breastfeeding lowered the SE
refraction by 0.12 D (standard error = 0.06; p = 0.03) after adjusting for
age, gender, history of breastfeeding, outdoor activity, mother’s education,
mother’s smoking history, parental myopia, birth weight, maternal age,
and child’s height. However, breastfeeding was not associated with myopia
(defined as SE at least –0.5 D) after controlling for the same confounders
(OR = 0.85; 95% CI = 0.62–1.18).
The SCORM investigated 797 school children aged 10 to 12 years
and reported that the multivariate OR of myopia (defined as SE at least
–0.5 D) for breastfed children was 0.58 (95% CI = 0.39–0.84) after
adjusting for the child’s age, sex, race, birth weight, height, number of
books read per week, IQ scores, mother’s education, parental myopia,
maternal age at delivery, household income, and clustering of siblings
within family (Table 7).
52
Moreover, the mean SE refraction of breastfed
38 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 38
3
9
E
n
v
i
r
o
n
m
e
n
t
a
l

R
i
s
k

F
a
c
t
o
r
s

f
o
r

M
y
o
p
i
a

i
n

C
h
i
l
d
r
e
n
Table 7. Evidence Table for Breastfeeding as Risk Factor for Myopia and Ocular Biometry
Age Definition of Association Association
Location/Study Study Design N Cycloplegic (Years) Myopia (SE) with SE with Myopia
Strabismus, Population-based, 2639 Yes 0.5–6 ≤–0.5 D + 0
Amblyopia and cross-sectional
Refractive Error
Study in
Singapore
Children
51
Singapore Cohort Cross-sectional 797 Yes 10–12 ≤–0.5 D + +
Study on
Risk Factors
for Myopia
52
AL: Axial length, D: Diopters, SE: Spherical equivalent, +: Association found, 0: Association evaluated but not found.
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
4

A
M


P
a
g
e

3
9
children (–1.6 D) was significantly less myopic than non-breastfed
children (–2.1 D; p = 0.01).
Conclusion
Both genes and environments are known to play important roles in the
onset and development of myopia. There is consensus that a family history
of myopia is a major risk factor for myopia and ocular biometry and
represents a surrogate for genetic or shared environmental factors.
However, current evidence also suggests that environmental factors such
as near work and outdoor activity are implicated in the development of
myopia and longer AL.
13–15,23,24,29
Near work is potentially modifiable but
given the emphasis on academic excellence in Asian cultures, reducing the
time spent on near work activity, particularly reading, may not be accept-
able to the parents and is unlikely to be implemented. Other environmen-
tal factors for myopia remain controversial. Greater height is associated
with longer AL but the relationship remains unclear with myopia.
Similarly, birth weight is positively associated with AL but the association
with spherical refraction is weak. Evidence suggests that exposure to
smoking in pregnancy and childhood may protect against myopia in chil-
dren. Breastfeeding appears to protect against myopia in Singapore chil-
dren but this finding requires validation in other populations and ethnic
groups.
Further studies should be conducted to determine the nature of the
association of time spent outdoors, and other possible risk factors such as
diet in longitudinal cohort studies that document the temporal sequence of
events. The issue of an accurate and precise quantification of “near work
activity” remains challenging and represents an area of in-depth study.
Particularly, near work “parameters” such as posture while reading, fre-
quency of close reading, breaks during reading and lighting conditions, are
modifiable and need to be further evaluated. Portable instruments that
record activity over a 24-hour period could document lighting levels, time
spent on close work in an objective manner. Randomized clinical trials
should be conducted to evaluate the efficacy of time spent outdoors to pro-
tect for myopia. The relative contribution of genetic and environmental
factors needs to be examined, and well-designed studies will be required to
tease out the interactions of genes-environmental mechanisms in the
development of myopia and changes in axial dimensions throughout life.
53
40 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 40
References
1. Kempen JH, et al. (2004) The prevalence of refractive errors among adults
in the United States, Western Europe, and Australia. Arch Ophthalmol 122(4):
495–505.
2. Lin LL, et al. (2004) Prevalence of myopia in Taiwanese schoolchildren: 1983
to 2000. Ann Acad Med Singapore 33(1): 27–33.
3. Lam CS, Goldschmidt E, Edwards MH. (2004) Prevalence of myopia in local
and international schools in Hong Kong. Optom Vis Sci 81(5): 317–322.
4. Wu HM, et al. (2001) Does education explain ethnic differences in myopia
prevalence? A population-based study of young adult males in Singapore.
Optom Vis Sci 78(4): 234–239.
5. Saw SM, et al. (2005) Myopia and associated pathological complications.
Ophthalmic Physiol Opt 25(5): 381–391.
6. Javitt JC, Chiang YP. (1994) The socioeconomic aspects of laser refractive
surgery. Arch Ophthalmol 112(12): 1526–1530.
7. Lim MC, et al. (2009) Direct costs of myopia in Singapore. Eye 23(5):
1086–1089.
8. Mutti DO, Zadnik K, Adams AJ. (1996) Myopia. The nature versus nurture
debate goes on. Invest Ophthalmol Vis Sci 37(6): 952–957.
9. Dirani M, et al. (2006) Heritability of refractive error and ocular biometrics:
the Genes in Myopia (GEM) twin study. Invest Ophthalmol Vis Sci 47(11):
4756–4761.
10. Pacella R, et al. (1999) Role of genetic factors in the etiology of juvenile-onset
myopia based on a longitudinal study of refractive error. Optom Vis Sci 76(6):
381–386.
11. Ashton GC. (1985) Segregation analysis of ocular refraction and myopia.
Hum Hered 35(4): 232–239.
12. Ciner E, et al. (2009) Genome-wide scan of African-American and white
families for linkage to myopia. Am J Ophthalmol 147(3): 512–517 e2.
13. Saw SM, et al. (2002) Nearwork in early-onset myopia. Invest Ophthalmol
Vis Sci 43(2): 332–329.
14. Rose KA, et al. (2008) Outdoor activity reduces the prevalence of myopia in
children. Ophthalmology 115(8): 1279–1285.
15. Dirani M, et al. (2009) Outdoor activity and myopia in Singapore teenage
children. Br J Ophthalmol 93(8): 997–1000.
16. Luo HD, et al. (2006) Defining myopia using refractive error and uncorrected
logMAR visual acuity >0.3 from 1334 Singapore school children ages
7–9 years. Br J Ophthalmol 90(3): 362–366.
17. Negrel AD, et al. (2000) Refractive Error Study in Children: sampling
and measurement methods for a multi-country survey. Am J Ophthalmol
129(4): 421–426.
41 Environmental Risk Factors for Myopia in Children
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 41
18. Ip JM, et al. (2007) Ethnic differences in the impact of parental myopia:
findings from a population-based study of 12-year-old Australian children.
Invest Ophthalmol Vis Sci 48(6): 2520–2528.
19. Zadnik K, et al. (1994) The effect of parental history of myopia on children’s
eye size. JAMA 271(17): 1323–1327.
20. Saw SM, et al. (2002) Component dependent risk factors for ocular parameters
in Singapore Chinese children. Ophthalmology 109(11): 2065–2071.
21. Goss DA, Jackson TW. (1996) Clinical findings before the onset of myopia in
youth: 4. Parental history of myopia. Optom Vis Sci 73(4): 279–82.
22. Yap M, et al. (1993) Role of heredity in the genesis of myopia. Ophthalmic
Physiol Opt 13(3): 316–319.
23. Jones LA, et al. (2007) Parental history of myopia, sports and outdoor activi-
ties, and future myopia. Invest Ophthalmol Vis Sci 48(8): 3524–3532.
24. Mutti DO, et al. (2002) Parental myopia, near work, school achievement, and
children’s refractive error. Invest Ophthalmol Vis Sci 43(12): 3633–3640.
25. Hui J, Peck L, Howland HC. (1995) Correlations between familial refractive
error and children’s non-cycloplegic refractions. Vision Res 35(9): 1353–1358.
26. Keller JT. (1973) A comparison of the refractive status of myopic children and
their parents. Am J Optom Arch Am Acad Optom 50(3): 206–211.
27. Lam DS, et al. (2008) The effect of parental history of myopia on children’s
eye size and growth: results of a longitudinal study. Invest Ophthalmol Vis Sci
49(3): 873–876.
28. Fan DS, et al. (2005) The effect of parental history of myopia on eye size of
pre-school children: A pilot study. Acta Ophthalmol Scand 83(4): 492–496.
29. Ip JM, et al. (2008) Role of near work in myopia: findings in a sample of
Australian school children. Invest Ophthalmol Vis Sci 49(7): 2903–2910.
30. Williams C, et al. (2008) A comparison of measures of reading and intelli-
gence as risk factors for the development of myopia in a UK cohort of chil-
dren. Br J Ophthalmol 92(8): 1117–1121.
31. Saw SM, et al. (2001) Myopia in Singapore kindergarten children. Optometry
72(5): 286–291.
32. Hepsen IF, Evereklioglu C, Bayramlar H. (2001) The effect of reading and
near-work on the development of myopia in emmetropic boys: a prospective,
controlled, three-year follow-up study. Vision Res 41(19): 2511–2520.
33. Mohan M, Pakrasi S, Garg SP. (1988) The role of environmental factors and
hereditary predisposition in the causation of low myopia. Acta Ophthalmol
Suppl 185: 54–57.
34. Richler A, Bear JC. (1980) Refraction, nearwork and education. A population
study in Newfoundland. Acta Ophthalmol (Copenh) 58(3): 468–478.
35. Tan GJ, et al. (2000) Cross-sectional study of near-work and myopia in
kindergarten children in Singapore. Ann Acad Med Singapore 29(6): 740–744.
42 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 42
36. Lu B, et al. (2009) Associations between near work, outdoor activity, and
myopia among adolescent students in rural China: the Xichang Pediatric
Refractive Error Study report no. 2. Arch Ophthalmol 127(6): 769–775.
37. Jacobsen N, Jensen H, Goldschmidt E. (2008) Does the level of physical
activity in university students influence development and progression of
myopia? — a 2-year prospective cohort study. Invest Ophthalmol Vis Sci
49(4): 1322–1327.
38. Saw SM, et al. (2002) Height and its relationship to refraction and biometry
parameters in Singapore Chinese children. Invest Ophthalmol Vis Sci 43(5):
1408–1413.
39. Ojaimi E, et al. (2005) Effect of stature and other anthropometric parameters
on eye size and refraction in a population-based study of Australian children.
Invest Ophthalmol Vis Sci 46(12): 4424–4429.
40. Wong TY, et al. (2001) The relationship between ocular dimensions and
refraction with adult stature: the Tanjong Pagar Survey. Invest Ophthalmol
Vis Sci 42(6): 1237–1242.
41. Lee KE, et al. (2009) Association of age, stature, and education with ocular
dimensions in an older white population. Arch Ophthalmol 127(1): 88–93.
42. Eysteinsson T, et al. (2005) Relationships between ocular dimensions and
adult stature among participants in the Reykjavik Eye Study. Acta Ophthalmol
Scand 83(6): 734–738.
43. Lim LS, et al. (2009) Distribution and determinants of ocular biometric
parameters in an Asian population: the Singapore Malay Eye Study. Invest
Ophthalmol Vis Sci.
44. Wu HM, et al. (2007) Association between stature, ocular biometry and
refraction in an adult population in rural Myanmar: the Meiktila eye study.
Clin Experiment Ophthalmol 35(9): 834–839.
45. Ojaimi E, et al. (2005) Impact of birth parameters on eye size in a population-
based study of 6-year-old Australian children. Am J Ophthalmol 140(3):
535–537.
46. Saw SM, et al. (2004) The relation between birth size and the results of refrac-
tive error and biometry measurements in children. Br J Ophthalmol 88(4):
538–542.
47. Dirani M, Islam FM, Baird PN. (2009) The role of birth weight in myopia —
the genes in myopia twin study. Ophthalmic Res 41(3): 154–159.
48. Saw SM, et al. (2004) Childhood myopia and parental smoking. Br J
Ophthalmol 88(7): 934–937.
49. Stone RA, et al. (2006) Associations between childhood refraction and
parental smoking. Invest Ophthalmol Vis Sci 47(10): 4277–4287.
50. Liang YB, et al. (2009) Refractive errors in a rural Chinese adult population
The Handan Eye Study. Ophthalmology.
43 Environmental Risk Factors for Myopia in Children
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 43
51. Sham WK, et al. (2009) Breastfeeding and association with refractive error in
young Singapore Chinese children. Eye.
52. Chong YS, et al. (2005) Association between breastfeeding and likelihood of
myopia in children. JAMA 293(24): 3001–3002.
53. Wong TY, Hyman L. (2008) Population-based studies in ophthalmology. Am
J Ophthalmol 146(5): 656–663.
44 W.C.J. Low, T.Y. Wong and S.-M. Saw
b846_Chapter-1.2.qxd 4/8/2010 1:54 AM Page 44
Gene-Environment Interactions
in the Aetiology of Myopia
Ian G. Morgan* and Kathryn A. Rose

The term “gene-environment interactions” in statistical genetics refers
to the possibility of different genotypes responding differentially to
environmental exposures. Myopia is an etiologically heterogeneous
disorder, in which there is a low prevalence of clearly genetic myopias,
which are generally strongly familial, early in onset and severe. In the last
few decades, there has been a marked increase in the prevalence of mild
to moderate myopia, particularly in urban East Asia. This increase
appears to be strongly associated with changing environmental exposures
involving increasingly intensive education and less time spent outdoors.
With analysis restricted to this form of acquired or school myopia, there
is abundant evidence for environmental impacts, but only limited
evidence for genetic contributions. Until the relevant genetic variation
has been identified, scientific analysis of gene-environment interactions
will not be possible. Currently, it is more parsimonious to interpret
school myopia as a disorder caused by environmentally induced excessive
axial elongation.
Introduction
After a period of flirtation with the idea that myopia was a predominantly
genetic disorder (for the early references, see Curtin, 1985
1
), myopia is now
45
1.3
*ARC Centre of Excellence in Vision Science, Research School of Biology, Australian National
University, Canberra, Australia. E-mail: [email protected]

Discipline of Orthoptics, Faculty of Health Sciences, University of Sydney, Lidcombe, Australia.
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 45
commonly regarded as a disorder in which both genes and environment
are involved, and in which gene-environment interactions may be impor-
tant.
2
At one level, the first part of this statement is trivial, since gene
expression must be involved in any biological process, including the devel-
opment of myopia. Refractive development of the eye involves changes in
the cellular composition and interactions of the cornea, lens, retina,
choroid and sclera. These changes must involve changes in gene expres-
sion. At the same time, genes must operate in an environment, and thus
genes and environment, acting together, are essential for the expression of
any biological trait.
From an epidemiological perspective, however, the important question
is not whether genes and environment are involved. They simply must be.
The important question is about the relationship between variations in
phenotype and variations in genotype and environmental factors. In this
context, the term “gene-environment interactions” has a very specific
meaning in statistical genetics. Martin
3
has stated this quite neatly:
“Many people who should know better use the term GxE to denote that
both genes and environment are important. Apart from the triviality of
such a sentiment (what manifestation of life is not ultimately coded for by
genes, and what life is not dependent on the supply of air, water, food from
the environment?), a better term is “genotype-environment co-action).
We should reserve for the term GxE its statistical sense of different
genotypes responding differentially to the same environment; or viewed
from the other end, some genotypes being more sensitive to changes in the
environment than others….”
From this biological perspective, the cells and molecules involved in
growth control pathways, which link detection of relevant variations in
visual input at the retinal level to regulation of sclera extracellular matrix
remodeling, must ultimately be encoded in the genome. Some of these
pathways have now been extensively studied (for a comprehensive review
see Ref. 4), and are also reviewed in other sections of this book. Expression
of some genes in these pathways must change when visual inputs lead
to changes in eye growth. But this is not evidence of gene-environment
interactions. This is simply evidence of environmental impacts on gene
expression.
46 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 46
Demonstrating gene-environment interactions in the etiology of myopia
and other refractive errors, requires analysis of three specific questions:
• Do genetic differences contribute to phenotypic variations in myopia?
• Do environmental exposures contribute to phenotypic variations in
myopia?
• Is there evidence of differential sensitivity of the different genotypes
characterized to environmental changes?
Aetiological Heterogeneity of Myopia
Analysis of these questions is complicated by the fact that myopia is clearly
heterogeneous in etiology, with relatively rare, clearly genetic severe forms,
and a broad category of school-juvenile-onset or “acquired” myopia,
which is generally mild to moderate in severity. This has become by far the
most common form in many populations.
5
Clearly genetic forms of myopia
Myopia is a common feature of a number of syndromes, such as Marfan
and Stickler syndromes. These are commonly, but not exclusively, asso-
ciated with mutations that affect connective tissue, and are typically
early onset and severe, with clear familial patterns of inheritance. There
are also several forms of early onset, severe, familial myopia, where the
primary characteristic is excessive axial elongation and myopia, often
referred to as the non-syndromic high myopias. The linked characteris-
tics of early onset and severity make these forms of myopia important
from a clinical perspective, because of their association with chorioreti-
nal pathologies.
Many of these forms of myopia clearly have a major genetic compo-
nent, and indeed, a number of relevant genes and chromosomal localiza-
tions have been identified (for reviews see Refs. 6 and 7). These forms of
myopia may be relatively resistant to environmental variations. Candidate
gene analysis has supported a role for polymorphisms in collagen iso-
forms, particularly COL2A1,
8
hepatocyte growth factor
9
and transforming
growth factor beta1.
10
However, in total, these forms of myopia account for
only few percent of myopia in the population.
47 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 47
School or acquired myopia
The situation is different with regard to school- or acquired myopia, which
is generally later in onset and mild to moderate in severity. This form of
myopia could be heterogeneous in etiology, but there is, at present, no real
evidence for this. This form often appears during the school years; hence
its name. In populations with little formal schooling it may hardly be
present,
11
while it may affect most of the school population in urban East
Asia.
12,13
In these parts of the world, the prevalence of myopia has
increased at a rapid rate over the past few decades, which is incompatible
with simple ideas of genetic determinism.
5
It has been argued that this form of myopia is genetic in origin, because
children with myopic parents are more likely to become myopic,
14,15
and
there are clear patterns of associated sibling risk.
16,17
The problem with this
argument is that families share environments, and it is not clear how much
of the familial clustering is due to shared genes and shared environ-
ments.
5,18
There is certainly evidence that when there has been rapid social
change, such that the environments in which children and parents grew up
were very different, as with the Eskimo and Inuit of North America during
the period in which the indigenous populations were moved into settle-
ments, parent-offspring correlations can almost completely disappear,
although sibling correlations remain substantial.
5,19
This shows that, at
least in certain circumstances, environmental variation can overshadow
genetic relationships.
It should be noted that distinguishing forms of myopia on the basis of
severity alone is problematic. The massive change in prevalence of myopia
in urban East Asia seems to be associated with earlier onset and more
rapid progression, leading to severe myopia by the end of schooling.
12
Thus high myopia in a low prevalence country may be predominantly
genetic, but in a high prevalence environment such as that of Taiwan,
much of the high myopia may itself be acquired, showing the same
features of rapid change in prevalence over the past few decades.
Misunderstandings of Heritability and Twin Studies
Heritability from twin studies has generally been taken as strong evidence
for a genetic basis to variation in myopia and refractive error, but the
limitations of such studies are often not appreciated. Modern twin studies
examine correlations in refractive status between genetically identical
48 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 48
monozygotic (MZ) twins, as compared to those for dizygotic (DZ) twins,
which share half their genes. For additive genetic effects, the correlations
between MZ twins are expected to be around twice those for DZ twins. If the
MZ correlations are significantly greater than twice the DZ correlations,
then this may be an indication of dominant genetic effects. Studies using
this approach have produced consistently high heritability values
for myopia as a category or for refractive error as a quantitative trait,
of around 80–90%.
20,21
This does not mean that 80–90% of myopia is
genetically determined, as is sometimes erroneously stated, but that
80–90% of the variance in myopia may be cautiously attributed to genetic
variation, provided that certain assumptions, such as the common envi-
ronment assumption, are met.
Unfortunately, the limitation of twin studies, and heritability analysis,
have often been ignored, despite the emphasis in textbooks of statistical
genetics on the fact that heritability values are specific to particular popu-
lations at particular times, and cannot be easily generalized. It is easy to
understand why — because in an analysis of the contribution of genetic
and environmental effects to phenotypic variation, if the range of relevant
environmental variation increases, then the genetic contribution must
decrease, and vice versa.
To give just one example of the dogmatic interpretation of twin studies,
on the basis of one of Sorsby’s early studies of twins,
22
the British Medical
Research Council concluded that:
“It may therefore be taken as established that the dimensions of the
optical components, the efficiency of the mechanism co-ordinating the
growth of the components and thus the refraction of the eye are all
genetically determined. The modes of inheritance and the possibility
that environmental factors have a minor modifying influence are the
principal problems now awaiting clarification.”
Despite the greater sophistication of current data analysis relative to the
simple analysis of Sorsby’s era, heritability analysis still depends on certain
assumptions, followed by mathematical modeling, and, as with all model-
ling, does not, and in principle, cannot prove that the phenotype has a
genetic basis. Unfortunately, this sort of claim is often made. It is impor-
tant to recognize that heritability analysis is about modeling the sources of
variation in the phenotype, and in the case of twin studies, the sources of
variation within twin pairs. This poses a major barrier to generalization,
49 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 49
since the characteristic of twin pairs is extremely restricted environmental
variation. This probably explains why more extended family studies, where
there is almost always greater environmental variation, almost always
result in lower estimates of heritability.
23–25
Hopper,
26
a leading statistical geneticist and Director of the Australian
Twin Register, has expressed some of the limitations of twin study analysis
in the following way:
“Therefore, the typical lack of evidence for shared or common environ-
ment effects resulting from textbook application of classical biometrical
modeling may not be a proper interpretation of reality. Such statistical
analysis, biased towards a genetic explanation and then interpreted as
evidence (if not proof!) that genetic factors alone are causing familial
aggregation, may be misleading … It is suggested that twin researchers
might benefit from taking a more critical approach to model fitting, and
in particular, trying to falsify genetic hypotheses.”
One of the critical assumptions of the classical modeling is the common
environment assumption, namely that the effects of environmental factors
shared by twins are independent of zygosity, and hence that higher corre-
lations within MZ pairs as compared with DZ pairs must be explained in
terms of genetic differences. Attempts to test this assumption have rarely
been made for any phenotype, and in any case must be trait-specific.
However, recently, heritability of one of the common environmental asso-
ciations of myopia, namely level of educational attainment, has been
examined in the context of a study of myopia.
27
The authors reported that
correlations in educational achievements were lower in DZ twins than in
MZ twins. But instead of interpreting this result as a falsification of the
common environment assumption in the case of refractive error, the
authors suggested that this was “proof ” that educational outcomes were
also genetically determined. This provides a logical trap, because this logic
means that unless the correlation in a trait is lower in MZ twins than in
DZ twins, a highly unlikely outcome, either the common environment
assumption will be confirmed, or another source of genetically deter-
mined impact will be “discovered.”
There is no basis to the common misinterpretations of high heritability,
such as the idea that high heritability values imply tight genetic determi-
nation and resistance to environmental impacts. There is, in fact, no
50 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 50
incompatibility between a high heritability of a trait and rapid and
massive environmental change.
28
Genotypes are expressed within particu-
lar environmental conditions, and even with simple Mendelian inheri-
tance, relevant variations in environmental conditions can lead to
variations in phenotype, changing the balance of genetic and environ-
mental contributions. This is simply more likely with complex multifacto-
rial diseases, with smaller changes in environmental exposures.
But Heritability has Its Uses
A more positive view of heritability is that high heritability values in twin
studies do not prove that there is a genetic basis to any condition, but they
validate the search for a genetic basis using modern molecular population
genetic tools. They also provide a privileged population for genetic studies,
DZ twins, where environmental variation is minimized, and average genetic
variation is understood. In the absence of a reasonable heritability value
from such studies, the highly expensive search for relevant genes would
arguably not be justified. The proof of a genetic basis will, however, only
come if genetic variation associated with variation in the trait is detected.
Evidence for Genetic Associations of School Myopia
So far, there has been little success, with little replication of studies. In a
follow-up molecular study on DZ twins from the Twin Eye Study,
Hammond and colleagues found a chromosomal localization suggestive of
the involvement of Pax6.
29
However, subsequent analysis on the British
1958 Birth Cohort did not find any association.
30
In addition, most of the
genes associated with syndromic and non-syndromic high myopias do not
seem to contribute to more moderate myopia.
31
Studies on socially isolated populations such as the Old Order Amish and
orthodox Ashkenazi Jews have so far given shared chromosomal localiza-
tions associated with refractive status in the two populations, despite what
would appear to be markedly different prevalence rates in the two popula-
tions. As the authors have pointed out,
32
this could be explained if
the genetic and environmental factors operated independently, with the
environmental factors shifting the overall distribution, while the genetic
factor determined the position within the distribution — in other words, if
51 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 51
there were separate genetic and environmental risk factors, but no gene-
environment interactions. It should be noted that as myopia prevalences
have changed, not only the mean, but also the shape of the distribution
has changed. This could be evidence of differential sensitivity in some
individuals, but it could also indicate differential exposure to whatever the
environmental effects are. The authors also cautioned that because of their
selection criteria (only one parent being myopic and more than one sibling
being myopic), they may be looking at autosomal dominant myopia, which
may make only a small contribution to the overall prevalence of school
myopia.
Baird and colleagues
33
have reported linkage of common myopia at
2q37.1 in three families from the GEM study. While the families were iden-
tified from probands with mild-moderate myopic, 35/49 members of the
families were myopic and over 10% were highly myopic, making this a
very unusual sample. It is therefore questionable whether these families are
representative of most cases of common myopia, and indeed a case-con-
trol association study failed to find significant associations between
myopia and this locus.
34
Polymorphisms in COL2A1 have also been identified as associated with
syndromic high myopia.
8
Mutti et al.
35
reported that COL2A1 polymor-
phisms were also associated with myopia, but a recent analysis by
Metlapally et al.
36
suggests that the association is with high, rather than
mild to moderate forms of myopia.
Two recent reports using candidate gene approaches are also of interest.
Analysis of the SCORM data has suggested associations between genetic
variation in the hepatocyte growth factor receptor c-Met
37
and myopia. In
this case, it is possible to calculate the prevalence of myopia in children
without, or with the susceptibility allele. In children without the mutation,
the prevalence is 61%; in children with one copy of the mutation, the
prevalence is 68%; and in children with two copies, the prevalence rate is
66%. None of the progression rates reported in the paper are statistically
different between the mutation groups. Thus, myopia develops in children
in Singapore irrespective of whether they carry the mutant form of c-Met
or not, but those with the mutation in c-Met become slightly more
myopic. It should be noted that the variation is associated with different
corneal powers, and not with different axial lengths. It will certainly be
interesting to see if this variation is replicated in other populations, and
what its relationship is to axial myopia. Strong impact on the prevalence
myopia of polymorphisms of matrix metalloproteases has also been
reported,
38
with a strong dose effect.
52 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 52
These emerging genetic associations with mild to moderate myopia set
the scene for proper studies of gene-environment interactions. But
because the evidence for such associations is very recent, such studies have
not yet been reported. Given this situation, two factors — ethnicity and
parental myopia — have been taken as potential surrogates for genetic dif-
ferences.
Evidence for the Impact of Environmental Factors
on Myopia Phenotypes
In contrast to the limited evidence for an impact of genetic variation
in school myopia, there is abundant evidence that suggests a role for
environmental factors in generating variation at the phenotypic level. We
have previously reviewed this material in some detail,
5
and will therefore
concentrate on newer evidence that adds to the picture.
One of the long-standing pieces of evidence for environmental impacts
has come from the association of higher prevalences of myopia with higher
educational achievements, and with near-work-intensive occupations. This
has led to a view that education, and the level of near-work and accommo-
dation involved leads to the development of myopia, and has inspired one
strand of myopia epidemiology. A number of different measures have been
taken in this area, ranging from educational achievements in adults, school
grades, IQ, number of books read, and attempts to determine hours spent
on near-work or sustained near-work, and taking account of viewing dis-
tance, calculations of dioptre, and hours of accommodative effect. Of these
various factors, educational achievements stand out as the most consistent
measure, while the more quantitative estimates of near-work and accom-
modation have given less convincing associations. As a result, the relevance
of near-work, either as a measure of accommodative effort, or as an esti-
mate of accommodative lag and hyperopic defocus has been questioned.
39
Recently, an apparently more powerful factor, time spent outdoors, has
been revealed in the Orinda study
40
and in the Sydney Myopia Study.
41
Gene-Environment Interactions and Ethnicity
The rapid increases in prevalence of myopia, particularly in urban East
Asia, over the past few decades, possibly associated with the expansion
of mass intensive education in those areas, suggest that changes in gene
53 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 53
pools cannot account for the rate of change that has been seen.
However, the concentration of the epidemic of myopia in urban East
Asia has been interpreted as indicating the current differences in preva-
lence of myopia between ethnic groups may be genetic in origin,
perhaps because of a concentration of susceptibility genes in those of
East Asia origin.
The available evidence does not favor this interpretation. First of all, it
is clear that East Asian, or even more specifically Chinese, origin, does not
necessarily lead to myopia. In addition to the earlier studies covered in our
2005 review,
5
which demonstrated major variation in the prevalence of
myopia for particular ethnic groups associated with different sites and
times, recent work has documented the differences in prevalence of
myopia in those of Chinese and Malay ethnicity, as well as Indian ethnic-
ity, in two countries as close together as Singapore and Malaysia,
42
and we
have shown marked differences in the prevalence of myopia between chil-
dren of Chinese origin in Singapore and Sydney.
43
However, this evidence
does not rule out ethnic genetic differences in susceptibility to environ-
mental factors.
On this issue, more conclusive evidence comes from studies on migrant
populations. The prevalence of myopia is generally low in children and
young adults in India, but shows some evidence of an urban-rural differ-
ence.
44,45
Myopia is higher in the Indian population of Malaysia,
42
and even
higher again in the Indian population of Singapore,
46
which approaches
that seen in the Chinese community. This suggests that people of Chinese,
Indian and Malay origin respond to the environment of Singapore with an
increased prevalence of myopia, which suggests that there is a broadly sim-
ilar susceptibility to the relevant environmental factors. The fact that, in
the environment of Singapore, Chinese are more myopic than Indians,
who are in turn more myopic than Malays, could be an indication of
differential susceptibility to the environmental factors, but given that this
difference in prevalence mirrors patterns of educational success,
47
and
engagement in outdoor activities,
48
it could also be attributed to differen-
tial environmental exposures alone. A similar picture is found in the chil-
dren from ethnic groups in Sydney, where the most myopic groups, those
of East Asian and South Asian origin,
49
achieve higher educational out-
comes, and engage in lesser amount of time in outdoor activities than
those of European origin.
In collaboration with the SCORM study, we have also compared in
detail children of Chinese origin growing up in Sydney with those of
54 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 54
Chinese origin growing up in Singapore, and found that the prevalence
of myopia in Sydney is lower. In the case of this study, ethnicity was
controlled for, and the level of parental myopia was very similar in the
two parent groups.
43
It, therefore, seems likely that the differences can
be attributed to environmental differences, of which the most obvious
was the higher amount of time spent outdoors by the children of
Chinese origin in Sydney than in Singapore. Unexpectedly, the less
myopic children of Chinese ethnicity in Sydney apparently performed
more near-work.
It is always possible to construct an argument as to how these results
could be explained in genetic terms. For example, it could be argued that
the Indians who migrated to Singapore were more susceptible to the devel-
opment of myopia than those who stayed at home. But to explain why the
children of South Asian origin in Sydney were much less myopic, it would
be necessary to postulate that those who migrated were less susceptible to
myopia. Similarly, it is possible that the Chinese who migrated south to
Singapore were as susceptible to the development of myopia as those who
remained behind, whereas those who migrated further south to Australia
were less susceptible. Despite some flaws in the study designs, the preva-
lence of myopia in Chinese Canadians
50
also seems quite high, which
might suggest that those who went north or east were more susceptible to
developing myopia. Overall, a series of ad hoc hypotheses is required to
interpret these data in terms of genetic differences, which is a characteris-
tic sign of a theory in crisis.
Almost all studies that have examined the issue have given evidence of
an association between high educational achievements and myopia.
5
While the studies are very limited for some ethnic groups, in all the ethnic
groups that have been examined there is evidence of such an association,
and there is no evidence that there is any differential susceptibility to edu-
cation between ethnic groups. One of the few anomalies in the literature
concerns the rapid appearance of high myopia prevalence rates in the Inuit
during the period of acculturation, when children were brought into set-
tlements and commenced formal education.
51
This appears to have hap-
pened when educational pressures were much lower than in Singapore,
and it is possible that genetic susceptibility might be involved. But given
the evidence for light exposures in reducing the prevalence of myopia, it is
also possible that the Inuit were particularly susceptible to environmental
change because of the pattern of light exposures characteristic of Arctic
environments.
55 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 55
Overall, with the present evidence, there is little evidence for genetic con-
tributions to the current differences in prevalence of myopia by ethnicity, and
correspondingly little evidence of a role for gene-environment interactions.
Gene-Environment Interactions and Parental Myopia
As a possible surrogate measure of differentially susceptible genomes,
parental myopia is a less than satisfactory measure, because it is clear that
environmental exposures are important, and that parents who are not
myopic may simply have not received the necessary environmental expo-
sures. Despite this limitation, most studies have shown a consistently
higher prevalence of myopia amongst those who have myopic parents as
compared with those who do not.
14,15,52,53
There has been some investigation of whether there is an interaction
between parental myopia and measures of education and near-work, with
results from the SCORM study suggesting an interaction,
52
whereas data
from the Orinda study do not.
14
Given the uncertainty about whether
near-work is a risk factor, further work in the area is required. Recent work
on the interaction between time spent outdoors and parental myopia
suggests that all children are protected by time spent outdoors, and the
risks decline in parallel for children with and without myopic parents.
40,41
Thus, there is no real evidence of gene-environment interactions in
relation to parental myopia.
Attempts have been made to explain the impact of parental myopia
in terms of a tendency for myopic parents to create myopigenic envi-
ronments characterized by intense education and little time spent out-
doors. This area deserves further study, but the very limited data
available show at most a slight tendency in this direction,
40,41
and the
effects would need to be highly nonlinear to explain the differences. It
should be noted that studies on populations of European origin
14,15,53
have shown several-fold differences in the prevalence of myopia
depending on parental myopia. A study of myopia across three genera-
tions in China
54
has, however, suggested that as the prevalence of
myopia increases, the impact of parental myopia declines. Consistent
with this, studies carried out at sites with characteristically high myopia
prevalence such as Singapore
52
and Guangzhou (Fan and He, personal
communication), the relative risk associated with parental myopia is
much more modest.
56 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 56
Overall, parental myopia appears to be more viable as a surro-
gate measure of genetic background and susceptibility than ethnicity,
but there is currently no convincing evidence of gene-environment
interactions.
Conclusion
Clearly much more data need to be collected for rigorous testing
of hypotheses. But, at this stage, putting to one side the clearly genetic
high familial myopias and hyperopia of >2D, there is little evidence for a
genetic basis to variations in refractive error, particularly of common
myopia. Strong evidence for gene-environment interactions in the
statistical genetic sense is lacking, although there is clear evidence for
an impact of environmental exposures on refractive outcomes independ-
ent of genetic background. Thus, since the evidence for gene-enviroment
interactions was reviewed in 2000,
55
there has been little progress, and
better definition of genetic contributions to school myopia and rigorous
analysis of gene-environment interactions are still necessary.
When we reviewed the etiology of myopia in 2005,
5
we concluded that
there was abundant evidence of environmental impacts on the prevalence
of myopia, but little evidence of significant genetic contributions to
myopia, apart from high myopia. The genetic evidence obtained since then
has not substantially changed this conclusion, although there are now a
few cases of potential genetic associations with some forms of mild to
moderate myopia, which provide the basis for looking at gene-environ-
ment interactions in the future. The use of ethnicity or parental myopia as
surrogate measures of genetic factors has not provided evidence of gene-
environment interactions.
Overall, we conclude that the evidence still favors the idea that myopia
is predominantly a disorder caused by abnormal environmental expo-
sures, and that the marked differences in prevalence associated with
ethnicity or educational attainments represent cases of simple environ-
mental effects, rather than cases of genetic determination or gene-
environment interactions. We, therefore, suggest that school myopia is
not primarily due to some sort of genetically determined failure of
emmetropization, but represents a case in which environmental expo-
sures that promote axial elongation, simply push the emmetropization
mechanism too far.
57 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 57
Acknowledgments
This work was supported by a grant from the Australian Research Council
to the ARC Centre of Excellence in Vision Science (COE956320).
References
1. Curtin BJ. (1985) The Myopias, Basic Science and Clinical Management.
Harper and Row, Philadelphia.
2. Saw SM, Katz J, Schein OD, et al. (1996) Epidemiology of myopia. Epidemiol
Rev 18: 175–187.
3. Martin N. (2000) Gene-environment interactions and twin studies. In
Spector TD, Snieder H, MacGregor AJ (eds.), Advances in Twin and Sib-pair
Analysis, pp. 143–150. Greenwich Medical Media, London.
4. Wallman J, Winawer J. (2004) Homeostasis of eye growth and the question of
myopia. Neuron 43: 447–468.
5. Morgan IG, Rose KA. (2005) How genetic is school myopia? Prog Retinal Eye
Res 25: 1–38.
6. Hornbeak DM, Young TL. (2009) Myopia genetics: A review of current
research and emerging trends. Curr Opin Ophthalmol 20: 356–362.
7. Tang WC, Yap MK, Yip SP. (2008) A review of current approaches to identify-
ing human genes involved in myopia. Clin Exp Optom 91: 4–22.
8. Ahmad NN, Dimascio J, Knowlton RG, Tasman WS. (1995) Stickler
syndrome. A mutation in the nonhelical 3′ end of type II procollagen gene.
Arch Ophthalmol 113: 1454–1457.
9. Han W, Yap MK, Wang J, Yip SP. (2006) Family-based association analysis of
hepatocyte growth factor (HGF) gene polymorphisms in high myopia. Invest
Ophthalmol Vis Sci 47: 2291–2299.
10. Zha Y, Leung KH, Lo KK, et al. (2009) TGFB1 as a susceptibility gene for
high myopia: A replication study with new findings. Arch Ophthalmol 127:
541–548.
11. Pokharel GP, Negrel AD, Munoz SR, Ellwein LB. (2000) Refractive Error Study
in Children: Results from Mechi Zone, Nepal. Am J Ophthalmol 129: 436–444.
12. Lin LL, Shih YF, Hsiao CK, Chen CJ. (2004) Prevalence of myopia in
Taiwanese schoolchildren: 1983 to 2000. Ann Acad Med Singapore 33: 27–33.
13. He M, Zeng J, Liu Y, et al. (2004) Refractive error and visual impairment in
urban children in southern China. Invest Ophthalmol Vis Sci 45: 793–799.
14. Mutti DO, Mitchell GL, Moeschberger ML, et al. (2002) Parental myopia, near
work, school achievement, and children’s refractive error. Invest Ophthalmol
Vis Sci 43: 3633–3640.
58 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 58
15. Pacella R, McLellan J, Grice K, et al. (1999) Role of genetic factors in the
etiology of juvenile-onset myopia based on a longitudinal study of refractive
error. Optom Vis Sci 76: 381–386.
16. The Framingham Offspring Eye Study Group (1996) Familial aggregation
and prevalence of myopia in the Framingham Offspring Eye Study. Arch
Ophthalmol 114: 326–332.
17. Fotouhi A, Etemadi A, Hashemi H, et al. (2007) Familial aggregation of
myopia in the Tehran eye study: estimation of the sibling and parent offspring
recurrence risk ratios. Br J Ophthalmol 91: 1440–1444.
18. Guggenheim JA, Pong-Wong R, Haley CS, et al. (2006) Correlations in refrac-
tive errors between siblings in the Singapore Cohort Study of Risk factors for
Myopia. Br J Ophthalmol 91: 781–784.
19. Guggenheim JA, Kirov G, Hodson SA. (2000) The heritability of high myopia:
a reanalysis of Goldschmidt’s data. J Med Genet 37: 227–231.
20. Lyhne N, Sjølie AK, Kyvik KO, Green A. (2001) The importance of genes and
environment for ocular refraction and its determiners: a population based
study among 20–45 year old twins. Br J Ophthalmol 85: 1470–1476.
21. Hammond CJ, Snieder H, Gilbert CE, Spector TD. (2001) Genes and envi-
ronment in refractive error: the twin eye study. Invest Ophthalmol Vis Sci 42:
1232–1236.
22. Sorsby A, Sheridan M, Leary GA. (1962) Refraction and its components in
twins. MRC Special Report #303, Medical Research Council, London.
23. Chen CY, Scurrah KJ, Stankovich J, et al. (2007) Heritability and shared envi-
ronment estimates for myopia and associated ocular biometric traits: the
Genes in Myopia (GEM) family study. Hum Genet 121: 511–520.
24. Klein AP, Suktitipat B, Duggal P, et al. (2009) Heritability analysis of spherical
equivalent, axial length, corneal curvature, and anterior chamber depth in the
Beaver Dam Eye Study. Arch Ophthalmol 127: 649–655.
25. Lopes MC, Andrew T, Carbonaro F, et al. (2009) Estimating heritability and
shared environmental effects for refractive error in twin and family studies.
Invest Ophthalmol Vis Sci 50: 126–131.
26. Hopper JL. (2000) Why “common environment effects” are so uncommon in
the literature. In: Spector TD, Snieder H, MacGregor AJ (eds.), Advances in
Twin and Sib-pair Analysis, pp. 152–163. Greenwich Medical Media, London.
27. Dirani M, Shekar SN, Baird PN. (2008) The role of educational attainment in
refraction: the Genes in Myopia (GEM) twin study. Invest Ophthalmol Vis Sci
49: 534–538.
28. Rose KA, Morgan IG, Smith W, Mitchell P. (2002) High heritability of myopia
does not preclude rapid changes in prevalence. Clin Experiment Ophthalmol
30: 168–172.
29. Hammond CJ, Andrew T, Mak YT, Spector TD. (2004) A susceptibility locus
for myopia in the normal population is linked to the PAX6 gene region on
59 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 59
chromosome 11: a genomewide scan of dizygotic twins. Am J Hum Genet 75:
294–304.
30. Simpson CL, Hysi P, Bhattacharya SS, et al. (2007) The Roles of PAX6 and
SOX2 in Myopia: lessons from the 1958 British Birth Cohort. Invest
Ophthalmol Vis Sci 48: 4421–4425.
31. Mutti DO, Semina E, Marazita M, et al. (2002) Genetic loci for pathological
myopia are not associated with juvenile myopia. Am J Med Genet 112:
355–360.
32. Wojciechowski R, Bailey-Wilson JE, Stambolian D. (2009) Fine-mapping of
candidate region in Amish and Ashkenazi families confirms linkage of refrac-
tive error to a QTL on 1p34-p36. Mol Vis 15: 1398–1406.
33. Chen CY, Stankovich J, Scurrah KJ, et al. (2007) Linkage replication of the
MYP12 locus in common myopia. Invest Ophthalmol Vis Sci 48: 4433–4439.
34. Schäche M, Chen CY, Pertile KK, et al. (2009) Fine mapping linkage analysis
identifies a novel susceptibility locus for myopia on chromosome 2q37
adjacent to but not overlapping MYP12. Mol Vis 15: 722–730.
35. Mutti DO, Cooper ME, O’Brien S, et al. (2007) Candidate gene and locus
analysis of myopia. Mol Vis 13: 1012–1019.
36. Metlapally R, Li YJ, Tran-Viet KN, et al. (2009) COL1A1 and COL2A1 genes
and myopia susceptibility: evidence of association and suggestive linkage to
the COL2A1 locus. Invest Ophthalmol Vis Sci 50: 4080–4086.
37. Khor CC, Grignani R, Ng DP, et al. (2009) cMET and refractive error
progression in children. Ophthalmology 116: 1469–1474.
38. Hall NF, Gale CR, Ye S, Martyn CN. (2009) Myopia and polymorphisms in
genes for matrix metalloproteinases. Invest Ophthalmol Vis Sci 50: 2632–2636.
39. Mutti DO, Zadnik K. (2009) Has near work’s star fallen? Optom Vis Sci
86: 76–78.
40. Jones LA, Sinnott LT, Mutti DO, et al. (2007) Parental history of myopia,
sports and outdoor activities, and future myopia. Invest Ophthalmol Vis Sci
48: 3524–3532.
41. Rose KA, Morgan IG, Ip J, et al. (2008) Outdoor activity reduces the preva-
lence of myopia in children. Ophthalmology 115: 1279–1285.
42. Saw SM, Goh PP, Cheng A, et al. (2006) Ethnicity-specific prevalences of
refractive errors vary in Asian children in neighbouring Malaysia and
Singapore. Br J Ophthalmol 90: 1230–1235.
43. Rose KA, Morgan IG, Smith W, et al. (2008) Myopia, lifestyle, and schooling
in students of Chinese ethnicity in Singapore and Sydney. Arch Ophthalmol
126: 527–530.
44. Dandona R, Dandona L, Srinivas M, et al. (2002) Refractive error in children
in a rural population in India. Invest Ophthalmol Vis Sci 43: 615–622.
45. Murthy GV, Gupta SK, Ellwein LB, et al. (2002) Refractive error in children in
an urban population in New Delhi. Invest Ophthalmol Vis Sci 43: 623–631.
60 I.G. Morgan and K.A. Rose
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 60
46. Wu HM, Seet B, Yap EP, et al. (2001) Does education explain ethnic differ-
ences in myopia prevalence? A population-based study of young adult males
in Singapore. Optom Vis Sci 78: 234–239.
47. Ministry of Education, Singapore. Education Statistics Digest 2008.
http://www.moe.gov.sg/education/education-statistics-digest/esd-2008.pdf
48. Dirani M, Tong L, Gazzard G, et al. (2009) Outdoor activity and myopia in
Singapore teenage children. Br J Ophthalmol 93: 997–1000.
49. Ip JM, Huynh SC, Robaei D, et al. (2008) Ethnic differences in refraction and
ocular biometry in a population-based sample of 11-15-year-old Australian
children. Eye 22: 649–656.
50. Cheng D, Schmid KL, Woo GC. (2007) Myopia prevalence in Chinese-
Canadian children in an optometric practice. Optom Vis Sci 84: 21–32.
51. Morgan RW, Speakman JS, Grimshaw SE. (1975) Inuit myopia: an environ-
mentally induced “epidemic”? Can Med Assoc J 8: 112: 575–577.
52. Saw SM, Nieto FJ, Katz J, et al. (2001) Familial clustering and myopia
progression in Singapore school children. Ophthalmic Epidemiol 8: 227–236.
53. Ip JM, Huynh SC, Robaei D, et al. (2007) Ethnic differences in the impact of
parental myopia: Findings from a population-based study of 12-year-old
Australian children. Invest Ophthalmol Vis Sci 48: 2520–2528.
54. Wu MM, Edwards MH. (1999) The effect of having myopic parents: an
analysis of myopia in three generations. Optom Vis Sci 76: 387–392.
55. Saw SM, Chua WH, Wu HM, et al. (2000) Myopia: gene-environment inter-
action. Ann Acad Med Singapore 29: 290–297.
61 Gene-Environment Interactions in the Aetiology of Myopia
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 61
b846_Chapter-1.3.qxd 4/8/2010 1:55 AM Page 62
This page intentionally left blank This page intentionally left blank
The Economics of Myopia
Marcus C.C. Lim* and Kevin D. Frick

The economics of myopia is not well elucidated. Economic evaluation
can take several forms. This chapter gives an overview of myopia
economics and provides a walkthrough for the calculation of the burden
of disease related to worldwide myopia. Directions for further research
are suggested.
Introduction
Economic science is the study of allocation of scarce resources.
Fundamentally, all forms of economic evaluation are undertaken for one
reason: Resources are limited and decision makers need guidance (which
is all that economic evaluation can provide) for making resource alloca-
tion decisions between alternatives. In health economics, resources include
time (for the patient and any caregivers), money, medical manpower and
other resources to produce health and health services. Economists are
interested in the modification of resource allocation or prices that will
change the way those resources are allocated and bring about a change in
health. With regard to myopia, questions that can be answered at a local or
global level by an economic evaluation include:
• What is the cost of vision correction for myopia?
• What is the total cost related to myopia, combining vision correction, the
costs of treating associated eye disease as well as loss of productivity?
63
1.4
*Singapore National Eye Centre, 11 Third Hospital Avenue, Singapore 168751.

Johns Hopkins Bloomberg School of Public Health, 624 N. Broadway, Rm. 606, Baltimore MD 21205,
USA. E-mail: [email protected]
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 63
• What benefits are there from vision correction of myopia? What is the
magnitude of future costs that will be offset?
• Does government subsidization of spectacles for myopes make
economic sense?
• How much could we save if there was a cure for myopia?
Economic evaluations
One purpose of economic evaluation is to describe and compare the costs
and benefits of health care services. This type of analysis can help us to
answer any of the questions above. One methodological step necessary to
perform economic analysis is to decide what set of costs and benefits
should be measured. The set of costs and benefits considered is defined by
the perspective taken, using economic jargon. The perspective could be the
hospital, the Ministry of Health, the government as a whole or society.
Generally, economists favor analyses at the broadest category, society.
From a societal perspective, an economic evaluation of myopia would
describe and compare the inputs (costs) and outputs (benefits) of treating
myopia for all those who are affected. The costs include the cost of optical
correction of myopia, in the form of spectacles, contacts lenses and refrac-
tive surgery, regardless of who pays. The benefits include increased
productivity and increased quality of life.
Since the outcome of every economic evaluation depends on both the
action contemplated and the alternative, it is important to specify the alter-
native. The alternative could be the status quo. If it is, the status quo must
be precisely defined. In our example, a course of action might be for gov-
ernment to fund spectacles for myopes. This would be compared with the
status quo alternative, which could be to continue with private funding.
Full vs partial evaluations
Economic evaluations can be classified into full or partial evaluations by
the answers to the following two questions
1
:
1) Does the evaluation look at both costs and benefits?
2) Does it involve two or more alternatives?
Translating these answers into a form of economic evaluation is demon-
strated in the table below.
1
64 M.C.C. Lim and K.D. Frick
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 64
The differences between cost-effectiveness analysis (CEA), cost-utility
analysis (CUA) or cost-benefit analysis (CBA) are the means of valuing the
health benefit. For CEA, the benefit measure is usually stated as $/change
in disease-specific measure of health-related benefits. For CUA, the result
is stated as $/Quality-Adjusted Life Year (QALY); for CBA, it is stated as
“Net benefit” ($(benefit)–$(cost)). In international settings, the result can
be expressed in local currency units.
Economic evaluation of myopia
Why perform an economic evaluation of myopia? Cynics might suggest
that this is an academic exercise and nothing more, as the correction of
myopia is not funded by the state in most countries. Free markets do not
require economic evaluations as it is assumed that individuals will only
make decisions that benefit their own interests. Countries that make
provincial or national provision and coverage decisions are more likely to
use economic evaluations, e.g. the United Kingdom, Canada and Australia
and not the United States. For example, in the United States, multiple
private insurers fund a significant portion of healthcare (for which the
market measures value rather than simulating a market through an
economic evaluation) while in the United Kingdom, it is the government-
controlled National Health Service, the world’s third largest employer, who
funds healthcare. Nevertheless, screening programs for refractive error are
becoming increasingly common throughout the world.
2
In addition,
research has shown that off-the-shelf spectacles are suitable for a large
65 The Economics of Myopia
Partial
CEA, CUA
or CBA
Does it involve two or more alternatives?
YES
NO
NO
YES
Partial
A description
of costs or
benefits
Does the
evaluation
look at
both costs
and
benefits?
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 65
proportion of uncorrected refractive error; an economic rationale for
governments to provide these is more likely to be justifiable.
3,4
Myopia is often given minor priority in public health research, yet the
societal costs of myopia can be considerable. In a broad view, costs include
not only the costs of optical correction, but also morbidity resulting from
eye diseases associated with myopia such as glaucoma, cataract, macu-
lopathy and retinal detachment. As a first step, conducting a study that
looks at only costs of the disease and treatment without considering alter-
natives is relatively simple to do. Studies that examine only costs of treating
the disease can be either cost-of-illness or burden-of-disease studies. The
former is concerned with costs from time of incidence, while the latter is
concerned with the costs of treating prevalent cases regardless of time of
incidence. These studies help to quantify the overall burden of a disease
and allow comparisons with burdens of other diseases of the costs of the
disease. Ultimately, economists prefer evaluations looking at both costs
and benefits. With sufficient information, a full economic evaluation
would look at costs and benefits of multiple alternatives.
The Economic Cost of Myopia: A Burden-of-Disease Study
At the simplest level, one could look into calculating the worldwide cost of
correcting myopia, a burden-of-disease evaluation. Initially, the prevalence
of myopia, or the number of myopes, must be estimated. The proportion
of myopes paying for correction and unit price data are also needed to
estimate the economic cost of myopia.
Annual cost of myopia = Number of paying myopes
× average amount spent per myope
= Population
× myopia prevalence
× proportion of myopes having correction
× proportion of myopes paying for correction
× average amount spent per myope.
(The reader should note that this is the “observed” burden. The “maximum”
burden would include treatment of all myopes.)
66 M.C.C. Lim and K.D. Frick
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 66
Data needed include:
i. Prevalence of myopia
ii. Proportion of myopes with correction/paying for correction
iii. Amount paid for myopic correction
i. Prevalence of myopia
The data for this comes from the numerous epidemiological studies carried
out around the world that have already been covered in detail in Chapter 1.1.
However, data for many countries are still lacking. We will estimate the
myopia prevalence in these countries based on data from neighboring
countries or countries with similar socioeconomic characteristics.
China
China is country with the largest population in the world; it is important
to use accurate figures for myopia prevalence. Numerous studies have been
published recently. A population-based study of an urban cohort in
Guangzhou, China, showed a prevalence of myopia of 32.3% in subjects
aged 50 years and above.
5
Urban 15-year-old school children had a myopia
prevalence rate of 73%.
6
Further, a study showed that 62.3% of 15-year-old
Chinese school children in a rural area were myopic.
7
Another study of
rural school children in Southern China found that 37% of 13-year-olds
were myopic, this figure rising to 54% of 17-year-olds, were myopic.
8
The
Beijing eye study showed that 22.9% of the population aged 40 to 90 years
of age in a mixed urban and rural cohort were myopic.
9
Table 1 shows an
estimation of the number of myopes in China. For adults aged 44 years
and above, data from the Beijing Eye Study
9
was used because the mixed
urban and rural cohort was more representative for the whole of the
country than other purely urban or rural cohorts.
India
India is the country with the second largest population in the world.
However, there are relatively few studies on myopia prevalence, which was
estimated to be 7% in an urban cohort in 5- to15-year-olds
10
and 4.1% of
7- to 15-year-olds in a rural cohort.
11
In South India, it was 27% for those
above 39-years of age.
12
The estimates used are shown in Table 2.
67 The Economics of Myopia
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 67
Europe
The estimated prevalence of myopia in subjects 40 years and above in
Western Europe is estimated at 26.6%, similar to that in the USA.
13
From
this we can assume that the myopia prevalence in those under 40 years of
age is similar to that in our calculations, and the prevalence for the whole
of Europe is assumed to be similar. The figure of 27% was used in our
model and this is reasonable as it is similar to the figure we computed from
more data, for the United States (see later). Assumptions such as these are
necessary due to lack of data.
Singapore
There are several studies detailing the prevalence of myopia in Singapore
and these are shown in Table 3.
68 M.C.C. Lim and K.D. Frick
Table 1. Prevalence of Myopia in China
Proportion
of Total Myopia
Age Population Population Prevalence Number
segment (%) Number (%) Source of Myopes
0–15 20.3 267,960,000 40.0 Guangzhou
6
107,184,000
15–29 22.8 300,960,000 30.0 Est. 90,288,000
30–44 26.7 352,440,000 26.0 Est. 91,634,400
45–59 18.2 240,240,000 22.9 Beijing
9
55,014,960
60–74 9.4 124,080,000 22.9 Beijing
9
28,414,320
75–84 2.3 30,360,000 22.9 Beijing
9
6,952,440
85+ 0.3 3,960,000 22.9 Beijing
9
906,840
Total 1,320,000,000 380,394,960
Table 2. Prevalence of Myopia in India
Proportion Prevalence No. of
Age Population (%) (%) Source Myopes
0–14 356,500,000 31 6 New Delhi
10
21,390,000
15–64 736,000,000 64 27 South India
12
198,720,000
65+ 57,500,000 5 27 South India
12
15,525,000
Total 1,150,000,000 235,635,000
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 68
Southeast Asia
In a predominantly Malay cohort, school-age children in a suburban area
near Kuala Lumpur in Malaysia had lower rates of myopia. In children
aged 7 years, 10% had myopia, this figure rising to 34% in 15-year-olds.
18
In Indonesia, it was 26.2%.
19
For our analysis, Indonesia, the fourth largest
country in the world, was taken to have a prevalence of myopia of 26%.
Africa
Myopia prevalence of 15-year-olds has been reported at 10%.
20
In
Ghanaian school children aged 6 to 22 years, it was 7%.
21
For students aged
11–27 years, the prevalence of myopia was 5.6%.
22
In general, myopia seems
to be less prevalent among those born and raised in Africa. There is little
data on myopia prevalence in adults so we use a figure of 10% for Africa.
USA
Estimates for the prevalence of myopia in the USA are shown in Table 4.
69 The Economics of Myopia
Table 3. Prevalence of Myopia in Singapore
Number of Percentage of Number of
Age People Myopes Source Myopes
0–4 196,500 5 Estimated 9825
5–9 240,100 29 Tan et al.
14
69,629
10–14 261,500 60 Estimated 156,900
15–19 249,900 74 Quek et al.
15
184,926
20–24 222,400 79 Wu et al.
16
175,696
25–29 257,300 70 Estimated 180,110
30–34 302,700 60 Estimated 181,620
35–39 308,200 60 Estimated 184,920
40–44 331,900 45 Tanjong Pagar
17
149,355
45–49 319,300 45 Tanjong Pagar
17
143,685
50–54 272,200 25 Tanjong Pagar
17
68,050
55–59 219,100 25 Tanjong Pagar
17
54,775
60–64 120,900 30 Tanjong Pagar
17
36,270
65–69 111,500 30 Tanjong Pagar
17
33,450
70–74 80,600 32 Tanjong Pagar
17
25,792
75–79 57,600 32 Tanjong Pagar
17
18,432
80+ 56,700 32 Estimated 18,144
Total 3,608,500 1,544,157
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 69
South America
The prevalence of myopia in Brazil
27
is similar to that of Europe, with 3.8%
in those under 5-years of age and 29.7% in those ranging from 30-to
39-years of age. In Los Angeles Latinos, it is 16.8% in those aged 40 years
and above, although this may not be a perfect comparison group as only
some Latinos in Los Angeles are first generation immigrants.
28
We will
assume an overall estimate of population prevalence of myopia in
South America of 21%.
Bangladesh
The prevalence of myopia was 22.1% in the over 30-year-olds.
29
We will
assume that this is the population prevalence of myopia for the purposes
of our estimate.
70 M.C.C. Lim and K.D. Frick
Table 4. Prevalence of myopia in the USA
Number Percentage Number of
Age of People
23
of Myopes (%) Source Myopes
0–4 20,417,636 2.7 Baltimore
24
551,276
5–9 19,709,887 10.1 CLEERE
25
1,970,989
10–14 20,627,397 10.1 CLEERE
25
2,062,740
15–19 21,324,186 15.0 Estimated 3,198,628
20–24 21,111,240 33.1 NHANES
26
6,987,820
25–29 20,709,480 33.1 NHANES
26
6,854,838
30–34 19,706,499 33.1 NHANES
26
6,522,851
35–39 21,185,785 33.1 NHANES
26
7,012,495
40–44 22,481,165 33.1 NHANES
26
7,441,266
45–49 22,797,569 33.1 NHANES
26
7,545,995
50–54 20,480,605 33.1 NHANES
26
6,779,080
55–59 18,224,445 33.1 NHANES
26
6,032,291
60–64 13,362,238 33.1 NHANES
26
4,422,901
65–69 10,375,554 33.1 NHANES
26
3,434,308
70–74 8,541,290 33.1 NHANES
26
2,827,167
75–79 7,381,027 33.1 NHANES
26
2,443,120
80+ 10,962,481 33.1 NHANES
26
3,628,581
Total 299,398,484 79,716,347
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 70
ii. Proportion of myopes paying for correction
Uncorrected and undercorrected refractive error, spectacle
coverage rate and reasons for spectacles nonwear
Because myopes who do not wear glasses are not included in our calcu-
lation, an estimate of the percentage of myopes who do not wear or no
longer wearing glasses is needed to complete the calculations. Studies
show that there is a large range of uncorrected or undercorrected refrac-
tive error in various populations (Table 5). Uncorrected refractive error
refers to individuals with refractive errors who do not use any form of
refractive correction, while undercorrected refractive error includes
individuals with uncorrected refractive errors and individuals with
refractive errors that are undercorrected by their prescriptions.
Undercorrected refractive error is also usually defined as improvement
of at least 2 lines of visual acuity in the better eye with the best possible
refractive correction.
From these studies we can estimate the number of myopes who are
paying, or not paying for vision correction. It has been estimated that there
are 153 million people aged 5-years and above worldwide with uncor-
rected refractive error.
38
Uncorrected refractive error can also be measured using a spectacle cov-
erage rate. This is the proportion of people with refractive error who have
glasses and can be expressed as the fraction “met need/(met need + unmet
71 The Economics of Myopia
Table 5. Uncorrected or Undercorrected Visual Acuity Globally
Uncorrected or Undercorrected*
Group Visual Acuity (%) Study
United States general population 5 NHANES
30
Mexican Americans 6 Projecto VER
31
Taiwanese 10 Shihpai
32
Elderly Australians 10 BMES
33
Los Angeles Latinos 15 LALES
34
Singapore Chinese* 17 Tanjong Pagar
35
China school children 19 XPRES
7
Singapore Malays* 29 SMES
36
India >66 Andhra Pradesh
37
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 71
need).” This is 66% in Tehran using a 20/40 visual acuity cutoff,
39
and
25.2% or 40.5% in Bangladesh, using 20/40 and 20/60 visual acuity cutoffs
respectively.
3
Even if subjects have glasses, there is evidence from other countries that
not all want to wear them. In Mexico, 493 school children received free
spectacles through a local program and underwent unannounced exami-
nation within 18 months.
2
Only 13.4% of them were found to be wearing
spectacles. The reasons they gave included appearance of the glasses or fear
of being teased. A study of Tanzanian school children showed that at
3 months, only 47% were wearing the free spectacles they had been given.
40
Of 580 Chinese children owning spectacles, 17.9% did not wear them at
school and a common reason for nonwear was the belief that spectacles
weaken the eyes.
41
In African school children, barriers to spectacles use
included peer pressure, parental concern about the safety of spectacles use
and their costs.
42
In Southern India, a population-based study found that
the prevalence of current spectacles use in those with spherical equivalent
+/−3.00 Diopters or worse was 34.2%, and among those who had used
spectacles previously, 43.8% discontinued because they felt either the
prescription was incorrect or the spectacles were uncomfortable.
37
However, there might be differences in cultural attitudes between coun-
tries as a study of Australian children found unnecessary or overuse of
spectacles.
43,44
The proportion of myopes with correction for each region
shown in Table 7.
iii. Amount paid for myopic correction
USA
In the USA, burden-of-disease studies have been carried out on myopia. It
has been estimated that US$2 billion per year in 1983
45
and US$4.6 billion
per year in 1994
46
were spent in the USA on correcting myopic refractive
errors. The figure in 1990 for vision products (eyeglass frames, lenses and
contact lenses) for all refractive errors is higher, at $US8.1 billion.
47
After adjustment for inflation (U.S. Department of Labor), this equates to
$13.4 billion.
A cross-sectional study in the USA showed that 110 million Americans
could and do achieve normal vision with refractive correction and the
estimated cost of this was US$3.8 billion
48
or approximately US$4.9 billion
72 M.C.C. Lim and K.D. Frick
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 72
today. From these studies we can estimate that the cost of optical correc-
tion of myopia lies in the range of US$2–5 billion. Since data are available,
we can use them to calculate the cost per myope in order to help us calculate
the cost of myopia in other countries with less data. Table 4 shows the cal-
culation for how the number of myopes in the USA is estimated to be
approximately 80 million. If we use a conservative estimate of the cost of
myopia correction to be $4 billion, then the annual amount spent per
myope is US$4 billion divided by 80 million which is US$50. Note that this
is the average amount spent annually for all myopes, whether they wear
glasses or change them regularly or not. The “true” cost is higher than this
as we estimate that 95% of myopes in this population buy optical correc-
tion aids.
30
The estimate may also be low because some myopes may not
change glasses annually.
Singapore
The cost data for a study of Singaporean school children aged 12–17 were
collected using questionnaires; the resulting estimate was that they spent an
average of S$222 (US$148) per year or a median of S$125 (US$83) on
glasses or contact lenses from opticians.
49
Unfortunately no data are avail-
able indicating how much is spent by other demographic groups on glasses,
laser refractive surgery and other complications resulting from myopia as
well as days lost from work. Thus we have to use the data from the single
age group to derive a bottom-up estimate for the direct costs of myopia.
This bottom-up approach entails estimating the costs of single elements
and then extrapolating upwards to the entire population, whereas a top-
down approach might look at the global cost of myopia and then working
downwards to an estimate for Singapore. Often both approaches are used
to determine if the estimates are in the correct magnitude.
The result is an annual figure of S$373m, or US$250m. Table 6 sum-
marizes the estimated total annual direct cost of myopia in Singapore.
Sensitivity analyses can also be carried out to calculate the upper and lower
bounds of our estimate. If we use the median annual cost of S$125 instead,
the annual cost is S$180m.
It can be argued that myopia correction in older adults (the average age
of the LASIK patient in a Singapore tertiary hospital is 33 years of age —
unpublished data) may be more costly especially with the advent of laser
refractive surgery. However, this does not necessarily result in a substantial
73 The Economics of Myopia
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 73
change in the economic cost of myopia as the cost of laser surgery may be
offset by future savings in spectacles and contact lenses. Contact lenses have
been shown to be more costly than LASIK, which is itself more costly than
eyeglasses.
50
If we take an average cost of LASIK to be US$2000 for both
eyes, then this is approximately the cost of 15 years of spectacles and con-
tact lenses, based on a mean annual cost of US$148. Javitt et al. found that
PRK was equivalent to wearing daily-wear soft contact lenses for 10 years.
46
The average age of the LASIK patient in Singapore is 33-years, as men-
tioned earlier. This patient, whom we still classify as “myopic,” has spent
US$3000 on LASIK, but does not have to pay for refractive correction for
the next 10–15 years, until she becomes presbyopic 10 years later, when she
will start spending approximately as much as a myope annually. This is
because myopes who have been rendered emmetropic by LASIK will have
to purchase reading glasses when they become presbyopic in their mid 40s.
74 M.C.C. Lim and K.D. Frick
Table 6. Cost of Myopia Correction in Singapore
Total
Annual Cost
Source of Annual in Singapore
Percentage Data for Cost Per Dollars (S$)
Number of Myopes Preceding Number Myope US$1≈S$1.50
Age of People (%) Column of Myopes ($) ($)
0–4 196,500 5 Estimated 9825 100 982,500
5–9 240,100 29 Tan et al.
14
69,629 222 15,388,009
10–14 261,500 60 Estimated 156,900 222 34,674,900
15–19 249,900 74 Quek et al.
15
184,926 222 40,868,646
20–24 222,400 79 Wu et al.
16
175,696 222 38,828,816
25–29 257,300 70 Estimated 180,110 222 39,804,310
30–34 302,700 60 Estimated 181,620 222 40,138,020
35–39 308,200 60 Estimated 184,920 222 40,867,320
40–44 331,900 45 Tanjong Pagar
17
149,355 222 33,007,455
45–49 319,300 45 Tanjong Pagar
17
143,685 222 31,754,385
50–54 272,200 25 Tanjong Pagar
17
68,050 222 15,039,050
55–59 219,100 25 Tanjong Pagar
17
54,775 222 12,105,275
60–64 120,900 30 Tanjong Pagar
17
36,270 222 8,015,670
65–69 111,500 30 Tanjong Pagar
17
33,450 222 7,392,450
70–74 80,600 32 Tanjong Pagar
17
25,792 222 5,700,032
75–79 57,600 32 Tanjong Pagar
17
18,432 222 4,073,472
80+ 56,700 32 Estimated 18,144 222 4,009,824
Total 3,608,500 372,650,134
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 74
The Singapore study
49
on myopic schooling teenagers found a conser-
vative median annual cost of US$83. This is slightly higher but in the same
magnitude as the USA estimate. This is probably because the Lim et al.
study was on a prospective cohort of myopes measuring actual expendi-
tures. In contrast, Vitale et al. used cost data based on Centers for Medicare
& Medicaid Services fee schedules for 2000, and expenditure data from
the Medical Expenditure Panel Survey. Also, the amount that a private
individual is willing to pay is larger than the amount the government is
willing to subsidize. The difference could be equated to the extra amount
private individuals are willing to pay for other factors such as design and
esthetics —it is possible to get a cheap pair of spectacles in Singapore for
US$35.
The burden of myopia
Table 7 shows the number of myopes, approximately 900 million, around
in the world who pay for vision correction. In the US, the annual cost is
approximately $US50. Since the Singapore cost estimate is higher, we used
the US cost data as a conservative estimate for the cost of myopia.
However, the cost in US dollars in poorer countries like India would be
lower than that in the USA, so we can use purchasing power parity to esti-
mate the cost of myopia in these countries. A pair of spectacles in USA is
the same as the cost of a pair of spectacles in Russia. In real life, it is not as
simple as that, but it will suffice for an approximation for the global cost
of myopia. Thus the global burden of myopia would be approximately
$US50 x 900 million, or $US45 billion.
Further Directions for Economic Research
A major limitation in our analysis is the paucity of cost data from large
regions of the world. This necessitated the extrapolation of cost data from
the USA, rather than from Singapore, as the USA cost data were more
conservative. Instead of just a burden of disease study, we could perform
partial and full evaluations examining the benefits of treating myopia as
well as the costs, and define possible alternatives of action. The benefits of
reducing myopia would include reduction of diseases which myopes are at
greater risk, e.g., cataract, glaucoma and retinal detachment, and their
attendant direct and indirect costs. Alternative courses of action might
include government programs for free sight tests and glasses.
75 The Economics of Myopia
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 75
7
6
M
.
C
.
C
.

L
i
m

a
n
d

K
.
D
.

F
r
i
c
k
Table 7. Estimation of Number of Myopes with Optical Correction Globally
Continents
Asia North America
Parameters China India Indonesia Pakistan Bangladesh Others Africa USA Mexico Canada Others Europe Australia TOTAL
Population, 1.32 1.15 0.23 0.17 0.15 1.01 0.92 0.30 0.11 0.03 0.09 0.38 0.73 0.03
billion
Total 3.88 0.92 0.53 0.38 0.73 0.03 6.47
population,
billion
Myopia 0.29 0.21 0.26 0.18 0.20 0.20 0.10 0.27 0.18 0.27 0.27 0.21 0.27 0.07
prevalence
No. of myopes 0.38 0.16 0.06 0.03 0.03 0.2 0.09 0.08 0.02 0.01 0.02 0.08 0.2 0.002 1.44
Percentage 80% 33% 50% 33% 33% 50% 20% 95% 80% 90% 80% 80% 90% 85%
of myopes
with
correction
No. of myopes 0.30 0.05 0.03 0.01 0.01 0.10 0.02 0.08 0.02 0.01 0.02 0.06 0.18 0.00 0.89
having
correction
South
America
b
8
4
6
_
C
h
a
p
t
e
r
-
1
.
4
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
5

A
M


P
a
g
e

7
6
References
1. Drummond MF, Schulpher MJ, Torrance GW, et al. (2005) Methods for the
Economic Evaluation of Health Care Programmes, 3rd ed. Oxford University
Press.
2. Castanon Holguin AM, Congdon N, Patel N, et al. (2006) Factors associated
with spectacle-wear compliance in school-aged Mexican children. Invest
Ophthalmol Vis Sci 47(3): 925–928.
3. Bourne RR, Dineen BP, Huq DM, et al. (2004) Correction of refractive error
in the adult population of Bangladesh: meeting the unmet need. Invest
Ophthalmol Vis Sci 45(2): 410–417.
4. Zeng Y, Keay L, He M, et al. (2009) A randomized, clinical trial evaluating
ready-made and custom spectacles delivered via a school-based screening
program in China. Ophthalmology 116(10): 1839–1845.
5. He M, Huang W, Li Y, et al. (2009) Refractive error and biometry in older
Chinese adults: the Liwan Eye Study. Invest Ophthalmol Vis Sci 50(11):
5130–5136.
6. He M, Zeng J, Liu Y, et al. (2004) Refractive error and visual impairment in
urban children in southern china. Invest Ophthalmol Vis Sci 45(3): 793–799.
7. Congdon N, Wang Y, Song Y, et al. (2008) Visual disability, visual function,
and myopia among rural chinese secondary school children: the Xichang
Pediatric Refractive Error Study (X-PRES) — report 1. Invest Ophthalmol Vis
Sci 49(7): 2888–2894.
8. He M, Huang W, Zheng Y, et al. (2007) Refractive error and visual impairment
in school children in rural southern China. Ophthalmology 114(2): 374–382.
9. Xu L, Li J, Cui T, et al. (2005) Refractive error in urban and rural adult Chinese
in Beijing. Ophthalmology 112(10): 1676–1683.
10. Murthy GV, Gupta SK, Ellwein LB, et al. (2002) Refractive error in children in
an urban population in New Delhi. Invest Ophthalmol Vis Sci 43(3): 623–631.
11. Dandona R, Dandona L, Srinivas M, et al. (2002) Refractive error in children
in a rural population in India. Invest Ophthalmol Vis Sci 43(3): 615–622.
12. Raju P, Ramesh SV, Arvind H, et al. (2004) Prevalence of refractive errors in
a rural South Indian population. Invest Ophthalmol Vis Sci 45(12):
4268–4272.
13. Kempen JH, Mitchell P, Lee KE, et al. (2004) The prevalence of refractive
errors among adults in the United States, Western Europe, and Australia. Arch
Ophthalmol 122(4): 495–505.
14. Tan GJ, Ng YP, Lim YC, et al. (2000) Cross-sectional study of near-work and
myopia in kindergarten children in Singapore. Ann Acad Med Singapore
29(6): 740–744.
15. Quek TP, Chua CG, Chong CS, et al. (2004) Prevalence of refractive errors
in teenage high school students in Singapore. Ophthalmic Physiol Opt 24(1):
47–55.
77 The Economics of Myopia
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 77
16. Wu HM, Seet B, Yap EP, et al. (2001) Does education explain ethnic differ-
ences in myopia prevalence? A population-based study of young adult males
in Singapore. Optom Vis Sci 78(4): 234–239.
17. Wong TY, Foster PJ, Hee J, et al. (2000) Prevalence and risk factors for
refractive errors in adult Chinese in Singapore. Invest Ophthalmol Vis Sci
41(9): 2486–2494.
18. Goh PP, Abqariyah Y, Pokharel GP, Ellwein LB (2005) Refractive error and
visual impairment in school-age children in Gombak District, Malaysia.
Ophthalmology 112(4): 678–685.
19. Saw SM, Gazzard G, Koh D, et al. (2002) Prevalence rates of refractive errors
in Sumatra, Indonesia. Invest Ophthalmol Vis Sci 43(10): 3174–3180.
20. Naidoo KS, Raghunandan A, Mashige KP, et al. (2003) Refractive error and
visual impairment in African children in South Africa. Invest Ophthalmol Vis
Sci 44(9): 3764–3770.
21. Ntim-Amponsah CT, Ofosu-Amaah S. (2007) Prevalence of refractive error
and other eye diseases in schoolchildren in the Greater Accra region of Ghana.
J Pediatr Ophthalmol Strabismus 44(5): 294–297.
22. Wedner SH, Ross DA, Todd J, et al. (2002) Myopia in secondary school
students in Mwanza City, Tanzania: the need for a national screening
programme. Br J Ophthalmol 86(11): 1200–1206.
23. Table 1: Annual Estimates of the Population by Five-Year Age Groups and
Sex for the United States: April 1, 2000 to July 1, 2006 (NC-EST2006-01).
Population Division, U.S. Census Bureau; 2007.
24. Giordano L, Friedman DS, Repka MX, et al. (2009) Prevalence of refractive
error among preschool children in an urban population: the Baltimore
Pediatric Eye Disease Study. Ophthalmology 116(4): 739–746, 46 e1–4.
25. Zadnik K, Manny RE, Yu JA, et al. (2003) Ocular component data in school-
children as a function of age and gender. Optom Vis Sci 80(3): 226–236.
26. Vitale S, Ellwein L, Cotch MF, et al. (2008) Prevalence of refractive error in the
United States, 1999–2004. Arch Ophthalmol 126(8): 1111–1119.
27. Schellini SA, Durkin SR, Hoyama E, et al. (2009) Prevalence of refractive
errors in a Brazilian population: the Botucatu eye study. Ophthalmic
Epidemiol 16(2): 90–97.
28. Tarczy-Hornoch K, Ying-Lai M, Varma R. (2006) Myopic refractive error in
adult Latinos: the Los Angeles Latino Eye Study. Invest Ophthalmol Vis Sci
47(5): 1845–1852.
29. Bourne RR, Dineen BP, Ali SM, et al. (2004) Prevalence of refractive error in
Bangladeshi adults: results of the National Blindness and Low Vision Survey
of Bangladesh. Ophthalmology 111(6): 1150–1160.
30. Vitale S, Cotch MF, Sperduto RD. (2006) Prevalence of visual impairment in
the United States. JAMA 295(18): 2158–2163.
78 M.C.C. Lim and K.D. Frick
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 78
31. Munoz B, West SK, Rodriguez J, et al. (2002) Blindness, visual impairment
and the problem of uncorrected refractive error in a Mexican-American
population: Proyecto VER. Invest Ophthalmol Vis Sci 43(3): 608–614.
32. Kuang TM, Tsai SY, Hsu WM, et al. (2007) Correctable visual impairment in
an elderly Chinese population in Taiwan: the Shihpai Eye Study. Invest
Ophthalmol Vis Sci 48(3): 1032–1037.
33. Thiagalingam S, Cumming RG, Mitchell P. (2002) Factors associated with
undercorrected refractive errors in an older population: the Blue Mountains
Eye Study. Br J Ophthalmol 86(9): 1041–1045.
34. Varma R, Wang MY, Ying-Lai M, et al. (2008) The prevalence and risk indica-
tors of uncorrected refractive error and unmet refractive need in Latinos: the
Los Angeles Latino Eye Study. Invest Ophthalmol Vis Sci 49(12): 5264–5273.
35. Saw SM, Foster PJ, Gazzard G, et al. (2004) Undercorrected refractive error in
Singaporean Chinese adults: the Tanjong Pagar survey. Ophthalmology
111(12): 2168–2174.
36. Rosman M, Wong TY, Tay WT, et al. (2009) Prevalence and risk factors of
undercorrected refractive errors among Singaporean Malay adults: the
Singapore Malay Eye Study. Invest Ophthalmol Vis Sci 50(8): 3621–3628.
37. Dandona R, Dandona L, Kovai V, et al. (2002) Population-based study of
spectacles use in southern India. Indian J Ophthalmol 50(2): 145–155.
38. Resnikoff S, Pascolini D, Mariotti SP, Pokharel GP. (2008) Global magnitude
of visual impairment caused by uncorrected refractive errors in 2004. Bull
World Health Organ 86(1): 63–70.
39. Fotouhi A, Hashemi H, Raissi B, Mohammad K. (2006) Uncorrected refrac-
tive errors and spectacle utilisation rate in Tehran: the unmet need. Br J
Ophthalmol 90(5): 534–537.
40. Wedner S, Masanja H, Bowman R, et al. (2008) Two strategies for correcting
refractive errors in school students in Tanzania: randomised comparison,
with implications for screening programmes. Br J Ophthalmol 92(1): 19–24.
41. Congdon N, Zheng M, Sharma A, et al. (2008) Prevalence and determinants
of spectacle nonwear among rural Chinese secondary schoolchildren: The
Xichang Pediatric Refractive Error Study Report 3. Arch Ophthalmol 126(12):
1717–1723.
42. Odedra N, Wedner SH, Shigongo ZS, et al. (2008) Barriers to spectacle use in
Tanzanian secondary school students. Ophthalmic Epidemiol 15(6): 410–417.
43. Robaei D, Kifley A, Rose KA, Mitchell P. (2006) Refractive error and patterns
of spectacle use in 12-year-old Australian children. Ophthalmology 113(9):
1567–1573.
44. Robaei D, Rose K, Kifley A, Mitchell P. (2005) Patterns of spectacle use in
young Australian school children: findings from a population-based study.
J AAPOS 9(6): 579–583.
79 The Economics of Myopia
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 79
45. Vision Research a national plan 1983–87: National Eye Advisory Council (US)
1983.
46. Javitt JC, Chiang YP. (1994) The socioeconomic aspects of laser refractive
surgery. Arch Ophthalmol 112(12): 1526–1530.
47. Levit KR, Lazenby HC, Cowan CA, Letsch SW. (1991) National health expen-
ditures, 1990. Health Care Fin Rev 13: 29–54.
48. Vitale S, Cotch MF, Sperduto R, Ellwein L. (2006) Costs of refractive correc-
tion of distance vision impairment in the United States, 1999–2002.
Ophthalmology 113(12): 2163–2170.
49. Lim MC, Gazzard G, Sim EL, et al. (2009) Direct costs of myopia in
Singapore. Eye 23(5): 1086–1089.
50. Berdeaux G, Alio JL, Martinez JM, et al. (2002) Socioeconomic aspects of laser
in situ keratomileusis, eyeglasses, and contact lenses in mild to moderate
myopia. J Cataract Refract Surg 28(11): 1914–1923.
80 M.C.C. Lim and K.D. Frick
b846_Chapter-1.4.qxd 4/8/2010 1:55 AM Page 80
Clinical Studies and
Pathologic Myopia
Section 2
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 82
This page intentionally left blank This page intentionally left blank
Quality of Life and Myopia
Ecosse L. Lamoureux*
,†,‡
and Hwee-Bee Wong
§,¶
The measurement of the impact of myopia from a patient’s point of view
has been advocated in the recent years. We provide a critical assessment of
the impact of myopia on vision-specific functioning, generic and vision-
specific health-related quality of life in children, adolescents, and adults.
We also comment on the important inclusion of modern psychometric
methods, particularly Rasch analysis, in future work associated with myopia
and the quality of life.
Introduction
Ophthalmology has traditionally relied on objective measurements of
vision impairment to represent patients’ functional capabilities. Measures
of visual acuity and visual field remain the main outcomes of interest.
1
However, over the last two decades, patient-centered benefits have become
important healthcare outcomes as clinicians, researchers, administrators,
and policy makers have concluded that measures such as visual acuity may
not capture all important aspects of vision functioning from a patient’s
perspective.
1–3
Within this new framework, an effective measurement of
the impact of vision loss from the patient’s point of view has become
83
2nd Reading
2.1
*Corresponding author. Department of Ophthalmology, University of Melbourne, 32 Gisborne Street,
East Melbourne, Victoria 3002, Australia. E-mail: [email protected]

Centre for Eye Research Australia, the Royal Victorian Eye and Ear Hospital, University of Melbourne,
East Melbourne, Australia.

Singapore Eye Research Institute, Singapore National Eye Centre, Republic of Singapore.
§
Health Services Research and Evaluation Division, Ministry of Health, 16 College Road, Singapore
169854, Republic of Singapore.

Department of Epidemiology and Public Health, Yong Loo Lin School of Medicine, National
University of Singapore, Singapore.
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 83
essential to determine the effectiveness of controlled clinical trials, clinical
audit, or outcomes research.
Since the measurement of patient-reported health outcomes aims at
understanding the effect of ocular diseases or impairment taken from the
patient’s perspective, there has been a plethora of instruments developed
to measure these concepts. Confusingly however, many authors refer to
instruments that simply measure disability or functioning as quality of
life (QoL). Disability is the limitation of a person’s ability to perform activ-
ities caused by a medical condition. Visual disability or restricted visual
functioning would be more appropriately called vision-related activity
limitation as advocated by the World Health Organization (WHO)
International Classification of Functioning, Disability and Health (ICF).
4
Compared to disability and functioning, health-related quality of life
(HRQoL) is a broader concept, which encompasses many issues that
impact a person’s life. HRQoL usually refers to the effect of a disease on the
way a person enjoys life, including the way the illness affects a person’s
ability to live free of pain, to work productively, and to interact with loved
ones. These issues are usually grouped into domains such as well-being,
symptoms, work/economic concerns, cognition, independence, and social
interaction.
There have been two common methods of assessing HRQoL. The first
involves generic instruments that measure broad aspects of health. Generic
HRQoL instruments provide a general sense of the effects of an illness but
not a particular medical condition. The Medical Outcomes Study Short-
Form Health Survey (SF-36) is one most used generic HRQoL instru-
ments.
5
The major limitation of generic HRQoL instruments is that they
do not assess potential condition-specific domains of HRQoL. Because of
this, they may not be sensitive enough to detect subtle treatment effects.
The second approach to measure HRQoL involves the use of instruments
that are specific to a disease. Measures geared toward specific diseases or
populations are likely to be more sensitive, and therefore, to have greater
relevance to practicing clinicians. Vision-specific HRQoL therefore inves-
tigates the impact of vision impairment on QoL, examining both the
impact and importance of each domain on QoL and allowing for variabil-
ity in the relevance of specific domains to individual respondents.
The measurement of the impact of myopia from a patient’s point of
view has been advocated in recent years. In this chapter, we provide a crit-
ical assessment of the research associated with the impact of myopia on
generic HRQoL, vision-specific functioning, and vision-specific HRQoL.
84 E.L. Lamoureux and H.-B. Wong
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 84
Impact of Myopia in Children, Adolescents and
Young Adults
In spite of the high prevalence rates of myopia in children, adolescents,
and young adults, particularly in Asian countries, there is a paucity of
research that has investigated myopia’s impact on functioning or HRQoL
in these younger populations (Table 1). The Pediatric Quality of Life
Inventory Version 4.0A (PedsQL 4.0) was recently utilized to assess the
impact of myopia in 1249 Singaporean adolescents aged 11 to 18 years.
6
The 23-item PedsQL 4.0 measures the core physical, mental, and social
health dimensions as delineated by the World Health Organization, as well
as role (school) functioning.
7
The scale comprises parallel child self-report
and parent-proxy report formats for age ranges of 5 to 7, 8 to 12, and 13 to
18 years. Respondents are asked about the difficulty of performing each
item over the past month (e.g. “It is hard for me to run”).
8
Responses are
made on a five-point Likert scale and scores are transformed to a 0 to 100
scale. Total and two subscale scores, i.e. physical and psychosocial health
summary scores, can then be derived, with higher scores indicating better
HRQoL. The total scores reported by high and low myopic adolescents
were not significantly different when compared to adolescents without
myopia (p > 0.05). This study, however, showed that presenting visual
impairment (VA [visual acuity] < 6/12) was associated with diminished
total HRQoL, psychosocial, and school functioning scores in healthy
85 Quality of Life and Myopia
Table 1. Details of Studies that have Investigated the Impact of Myopia on Generic
Health and Vision-specific Functioning in Children, Adolescents, and Young Adults
Age Sample
Author Country Range Size Study Design Measure
Wong et al., Singapore 11 to 18 1249 Cross-sectional, PedsQL 4.0 Generic
2009
6
school-based Core Scales
Saw et al., Singapore 15 to 18 699 Cross-sectional, Time trade off
2003
13
school-based and standard
gamble for death
Lim et al., Singapore 18 to 22 120 Cross-sectional, Utility values:
2005
14
school-based Time trade off
and standard
gamble for death
Congdon et al., China 13–17 1892 Cross-sectional, Vision-specific
2008
15
school-based functioning
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 85
adolescents without any medical problems. Since the best-corrected VA
was not assessed, visual impairment attributable to uncorrected refractive
error could not be determined in these adolescents.
Other generic HRQoL methods have also been used to determine the
impact of myopia. Utility values are measures that assess the QoL associated
with a health state.
9–11
Utility values traditionally range from 1.0, associated
with perfect health, to 0.0, associated with death. Scores approximating a
value of 1.0 indicate a better QoL associated with a health state. Conversely,
those closer to 0.0 suggest poorer levels of QoL.
9
Time-Trade-Off (TTO) is
also another technique used to help determine the QoL of a patient or
group. Similarly, the Standard Gamble (SG) technique is a traditional
technique of measuring preferences under uncertainty. It is used to measure
utility functions over life-years and health states, as well as the preference
weights to be used in the Quality Adjusted Life Years (QALY) calculations.
12
Two studies in Singapore have been conducted to examine the utility values
in myopic students. The first involved 699 myopic students aged 15 to 18
years who reported that the mean time trade-off (years of life willing to be
sacrificed) and standard gamble (risk of blindness from therapy willing to
be sacrificed), utility values for treatment of myopia were not related to the
severity of myopia.
13
They reported that myopic teenagers with better
presenting visual acuity (LogMAR [Logarithm of the Minimum Angle of
Resolution] <0.3), for those who wore glasses or contact lenses, had a higher
total family income, had more “academic”schooling, and were non-Muslim,
reported higher utility values.
Another Singaporean study of 120 university myopic medical students
aged 18 to 22 years examined time trade-off and standard gamble utility
values for treatment of myopia. No relationship between utility values and
severity of myopia was found. The utility values reported was higher (time
trade-off 0.97 and standard gamble for death 0.99)
14
than those obtained
from other ophthalmic conditions, such as diabetic retinopathy and
age-related macular degeneration, suggesting myopia may have less
impact compared to other ocular conditions. Also, as the medical students
included in this study differed in age, education level, religion, and race
from the general adult population in Singapore, these results may not be
generalizable to the population.
Data on the impact of myopia on vision-specific functioning (VSF)
is also very scarce. A visual functioning questionnaire was used to
assess the impact of myopia in rural Chinese secondary school children.
15
In this cohort of middle school children, myopia was significantly and
86 E.L. Lamoureux and H.-B. Wong
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 86
monotonically associated with worse self-reported visual functioning.
Myopic refractive error was more strongly associated with self-reported
visual function than was presenting vision.
15
The findings of this study are
substantiated by a recent trial demonstrating a significant improvement in
VSF with provision of glasses among school-aged children having modest
levels of refractive error in rural Mexico.
16
The VSF score in that study
was calculated using the Refraction Status Vision Profile (RSVP) scale
17
designed specifically to measure the impact of refractive error and its
correction on visual functioning.
Impact of Myopia in Adults
Compared to younger populations, the impact of myopia and refractive
error on QoL in adults has been marginally better evaluated (Table 2). In
Japan, 200 pathological myopia patients (refraction exceeding −8.0 D
[diopter] in one eye or both eyes, aged 18 years and above) reported poorer
scores in eye and life satisfaction after adjusting for their daily life activities
compared to control patients who had best corrected visual acuity better
than 0.8; refractive error between −3.0 and +3.0 D; and no ocular disease.
18
In contrast, the general well-being schedule score, which evaluated the
patient’s psychological status over the last month, was not reduced in
the pathologic myopia patients. This is the only study assessing QoL of
pathological myopia patients and thus comparative analyses are difficult.
Generic HRQoL has been also evaluated in patients with correctable
visual impairment in different countries. A population-based study of
3153 Australians aged 49 to 98 years, reported that age and sex adjusted
HRQoL scores (as measured using the SF-36 questionnaire
5
), was not
affected in participants with unilateral visual impairment correctable
by refraction.
19
The medical conditions of the participants, such as co-
morbidity or disabilities, were however not adjusted in these analyses and
may have confounded the study findings.
20
When participants with bilateral
correctable visual impairment of the same Australian cohort (n = 3154)
were examined, significant lower scores were reported for physical func-
tioning, social functioning, and the physical component when compared
with those with no visual impairment.
21
In a smaller population-based
Taiwanese study (n = 1361) that included participants aged 65 and above,
it was shown that bilateral correctable visual impairment has an impact
only in the physical functioning dimension score of SF-36, but no significant
87 Quality of Life and Myopia
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 87
8
8
E
.
L
.

L
a
m
o
u
r
e
u
x

a
n
d

H
.
-
B
.

W
o
n
g
Table 2. Details of Studies that have Investigated the Impact of Myopia on Generic Health and Vision-specific Functioning in Adults
Author Country Age Range Sample Size Study Design Measure
Takashima et al., 2001
18
Japan 18 and above 200 Cross-sectional, clinic-based Self-rating questionnaire
(Indices of QoL: General
well-being schedule,
eye satisfaction,
life satisfaction)
Chia et al., 2003
19
Australia 49 to 98 3153 Cross-sectional, SF-36
population-based
Owsley et al., 2007
27
United States of 55 and above 142 Longitudinal, nursing NHVQoL, SF-36, VF-14
America home-based
Chia et al., 2004
21
Australia 49 to 98 3154 Cross-sectional, SF-36
population-based
Kuang et al., 2007
22
Taiwan 65 and above 1361 Cross-sectional, SF-36
population-based
Hollands et al., 2009
23
Canada 15 to 81 193 Cross-sectional, SF-12
community-based
Lamoureux et al., 2009
24
Singapore 40 to 80 2912 Cross-sectional, VF-11
population-based
Chen et al., 2007
25
Australia 18 and above 195 Cross-sectional, clinic-based VisQoL
Rose et al., 2000
26
United Kingdom 18 to 65 112 Cross-sectional, clinical-based VQoL, VF14
Broman et al., 2002
28
United States of 40 to 96 4550 Cross-sectional, NEI-VFQ-25
America population-based
Chia et al., 2006
29
Australia 50 and above 892 Cross-sectional, NEI-VFQ-25
population-based
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
1
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
5

A
M


P
a
g
e

8
8
difference was found in the other seven dimensions.
22
Unfortunately, the
mean scores for each dimension between participants with correctable
visual impairment and those without visual impairment were not
reported. Hence, it is difficult to assess if the insignificant difference in
social functioning and the physical component was due to the insufficient
sample size in this study (127 with correctable visual impairment). Poorer
physical component scores of SF-12 were also reported by adults aged
15 to 81 years with visual impairment due to either refractive or patho-
logical causes, selected from the poorest community in Canada.
23
Although the study had a small sample size and non-randomly selected
study population, their finding also suggested that visual impairment
detrimentally affected the physical score of generic QoL.
The vision-specific functioning of patients with corrected and uncor-
rected myopia was assessed with the VF-11 (a modified version of VF-14)
in a recent population-based study of Singaporean Malays.
24
Uncorrected
myopia was found to be independently associated with poorer overall
functioning score and vision-related activities (e.g. reading street signs,
recognizing friends, and watching television), but not corrected myopia.
This finding suggests that myopia alone does not have an effect on daily
activities, but myopia that remains uncorrected affects visual functioning.
This finding, however, differs from that found in an Australian study,
which showed that corrected myopia affects vision-related QoL. Participants
with myopia corrected with glasses or contact lenses (best corrected visual
acuity >20/20) reported a negative impact on some specific aspects of
vision-related QoL, such as having concerns about injuring themselves,
difficulties coping with demands in their lives, difficulties fulfilling their
work, family, and community roles, and less confidence joining in every-
day activities.
25
Cultural, study design, and sample size differences may
account for the discrepancies between these two studies. Critically though,
corrected myopia in the Australian study was more related to the
emotional and psychosocial impact of myopia, which was not assessed in
the study in Singapore.
A study in United Kingdom investigated the relationship between the
severity of myopia and vision-related QoL, as measured by Vision Core
Measure 1 (VCM1).
26
Patients with severe myopia reported poorer quality
of life scores when compared to those with moderate and low levels of
myopia. Unfortunately, the findings of this study were limited by a low
response rate (28%), and the analyses were not stratified for the correction
89 Quality of Life and Myopia
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 89
of refractive error. Similar to myopic patients, poorer functioning scores
were also reported by nursing home residents who had uncorrected
refractive error in one or both eyes.
27
Although data pertaining to the impact of myopia per se is limited, there
is some information about the impact of uncorrected refractive error on
vision-specific HRQoL. In 4550 Hispanics adults aged 40 to 96 years,
visual impairment due to refractive errors was associated with decrements
on several subscales of the National Eye Institute Visual Function
Questionnaire (NEI-VFQ-25) scale, including general vision, distance
vision, driving, peripheral vision, role difficulties, dependency, social func-
tioning, and mental health when compared to those with no eye disease
and without uncorrected refractive error.
28
Lower NEI-VFQ-25 scores
(eight dimensions, including the composite score) were also reported by
Australians participants with bilateral visual impairment due to uncor-
rected refractive error, but not in those with unilateral visual impair-
ment.
29
Both studies using the NEI-VFQ-25 scale, however, did not adjust
for general health status or non-ocular comorbidities, which have been
shown to impact vision-specific HRQoL.
20
This may have confounded
their findings. Uncorrected refractive error was also associated with a
decrement in the nursing home vision-targeted health-related quality of
life (NHVQoL) subscales of general vision, reading, psychological distress,
activities and hobbies, and social interaction, reported by nursing home
residents.
27
Overall Conclusion
In spite of myopia being a growing public health problem and its preva-
lence and severity increasing in different parts of the world, particularly
in Asia,
30–32
there is remarkably limited data about its impact on HRQoL.
In children and younger adults, the limited findings indicate that myopia
has little or no impact on general health. On the other hand, and perhaps
as anticipated, the meager available data suggest a systematic and positive
relationship between worsening levels of myopia and poorer vision-specific
functioning. In addition, the available current information seems to
indicate that myopia is associated with visual disabilities other than visual
acuity measurements, potentially including micropsia and deficits of periph-
eral vision among children wearing corrective glasses.
15
Considering the
90 E.L. Lamoureux and H.-B. Wong
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 90
limited available evidence, more work is needed to gain a better under-
standing of the impact of myopia on vision-specific functioning and HRQoL
in children and younger adults not only in Asia but also other countries.
In adults, unilateral visual impairment associated with refractive error
(including myopia) appears to have a limited impact general health.
However, bilateral correctable visual impairment and severe stage myopia
negatively impact general and vision-specific HRQoL. Correction of
myopia does not impact on vision-specific functioning
24
although more
information is needed to establish its impact on emotional well-being and
social inclusion.
25
Future Studies
Future work to improve the understanding of the impact of myopia
should focus on myopia-specific QoL scales, which include a number of
life domains such as well-being, economic concerns, cognition, independ-
ence, and social interaction. Our understanding of the impact of myopia
in these areas is limited. There is also a need for future investigators to use
modern psychometric methods to analyze questionnaire data. With the
exception of one study, most studies have used Classical Test Theory meth-
ods such as a mean or summary score.
24
Summary scoring, termed Likert
scoring, allocates an ordinal assignment of a numerical value to a partici-
pant’s response and assumes a score based on an interval scale. The valid-
ity of such summary scores has been questioned by the Item Response
Theory (IRT) methods, namely Rasch analysis.
2,33–36
Rasch analysis states
that the probability of an individual choosing a response on a particular
item depends on both the person’s ability and item difficulty. Thus, Rasch
analysis is taken as a criterion for the structure of the responses, which
should be satisfied rather than a simple statistical description of the
responses commonly evidenced in studies that have investigated the
impact of myopia. Once the data fits the Rasch model, estimates of meas-
ures on an interval scaling are provided, which can improve the accuracy
of scoring and remove measurement noise.
35,37–39
The transformed score
can then be used in analysis of variance and regression more readily than
the raw score, which has floor and ceiling effects. The utilization of some
form of IRT in future studies will ensure an improved measurement of the
impact of myopia on HRQoL.
91 Quality of Life and Myopia
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 91
Finally, reports have suggested that there is an “epidemic” of myopia
in Asia. Population-based studies in urban Asian cities indicate a high
prevalence of myopia compared to European-derived populations.
40–42
Paradoxically, there has been very little work undertaken in these countries
to better understand the impact of myopia, particularly in adults. Valid
vision-specific QoL questionnaires are needed to determine the impact of
myopia and refractive error on all aspects of daily living in Asian countries.
Several scales have been developed in Western countries, such as the
Refractive Status and Vision Profile,
17
the National Eye Institute Refractive
Quality of Life,
43
and the Quality of Life Impact of Refractive Correction.
39
These scales either should be validated in Asian cultures or new scales
specific to Asian countries need to be developed and validated, preferably
using IRT methods.
References
1. Massof RW, Rubin GS. (2001) Visual function assessment questionnaires.
Survey of Ophthalmol 45: 531–548.
2. Lamoureux EL, Pallant JF, Pesudovs K, et al. (2006) The Impact of Vision
Impairment Questionnaire: an evaluation of its measurement properties using
Rasch analysis. Investigative Ophthalmol Vis Sci 47: 4732–4741.
3. Stelmack J. (2001) Quality of life of low-vision patients and outcomes of
low-vision rehabilitation. Optom Vis Sci 78: 335–342.
4. World Health Organization. (2001) The international classification of func-
tioning, disability and health (ICF). World Health Organization, Geneva,
Switzerland.
5. Ware JE Jr, Sherbourne CD. (1992) The MOS 36-item short-form health
survey (SF-36). I. Conceptual framework and item selection. Med Care 30:
473–483.
6. Wong HB, Machin D, Tan SB, et al. (2009) Visual impairment and its impact
on health-related quality of life in adolescents. Am J Ophthalmol 147:
505–511 e1.
7. WHO. (1948) Constitution of the World Health Organization basic document,
p. 1. World Health Organization, Geneva, Switzerland.
8. Varni JW, Seid M, Kurtin PS. (2001) PedsQL 4.0: Reliability and validity of the
Pediatric Quality of Life Inventory version 4.0 generic core scales in healthy
and patient populations. Med Care, 39: 800–812.
9. Brown GC, Brown MM, Sharma S, et al. (2001) The reproducibility of
ophthalmic utility values. Trans Am Ophthalmol Soc 99: 199–203; discussion
203–204.
92 E.L. Lamoureux and H.-B. Wong
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 92
10. Brown MM, Brown GC, Sharma S, Garrett S. (1999) Evidence-based
medicine, utilities, and quality of life. Curr Opinion Ophthalmol 10: 221–226.
11. Torrance GW. (1986) Measurement of health state utilities for economic
appraisal. J Health Econ 5: 1–30.
12. Gafni A. (1994) The standard gamble method: what is being measured and
how it is interpreted. Health Serv Res 29: 207–224.
13. Saw SM, Gazzard G, Au Eong, KG, Koh D. (2003) Utility values and myopia
in teenage school students. Br J Ophthalmol 87: 341–345.
14. Lim WY, Saw SM, Singh MK, Au Eong KG (2005) Utility values and myopia
in medical students in Singapore. Clin Exp Ophthalmol 33: 598–603.
15. Congdon N, Wang Y, Song Y, et al. (2008) Visual disability, visual function,
and myopia among rural chinese secondary school children: the Xichang
Pediatric Refractive Error Study (X-PRES) — report 1. Inv Ophthalmol & Vis
Sci 49: 2888–2894.
16. Esteso P, Castanon A, Toledo S, et al. (2007) Correction of moderate myopia
is associated with improvement in self-reported visual functioning among
Mexican school-aged children. Inv Ophthalmol & Vis Sci 48: 4949–4954.
17. Vitale S, Schein OD, Meinert CL and Steinberg EP. (2000) The refractive
status and vision profile: a questionnaire to measure vision-related quality of
life in persons with refractive error. Ophthalmol 107: 1529–1539.
18. Takashima T, Yokoyama T, Futagami S, et al. (2001) The quality of life in
patients with pathologic myopia. Jap J Ophthalmol 45: 84–92.
19. Chia EM, Mitchell P, Rochtchina E, et al. (2003) Unilateral visual impairment
and health related quality of life: the Blue Mountains Eye Study. Br J
Ophthalmol 87: 392–395.
20. Ahmadian L, Massof R. (2008) Impact of general health status on validity of
visual impairment measurement. Ophth Epidemiol 15: 345–355.
21. Chia EM, Wang JJ, Rochtchina E, et al. (2004) Impact of bilateral visual
impairment on health-related quality of life: the Blue Mountains Eye Study.
Inv Ophthalmol Vis Sci 45: 71–76.
22. Kuang TM, Tsai SY, Hsu WM, et al. (2007) Correctable visual impairment in
an elderly Chinese population in Taiwan: the Shihpai Eye Study. Inv
Ophthalmol Vis Sci 48: 1032–1037.
23. Hollands H, Brox AC, Chang A, et al. (2009) Correctable visual impairment
and its impact on quality of life in a marginalized Canadian neighbourhood.
Can J Ophthalmol 44: 42–48.
24. Lamoureux EL, Saw SM, Thumboo J, et al. (2009) The impact of corrected
and uncorrected refractive error on visual functioning: the Singapore Malay
Eye Study. Inv Ophthalmol Vis Sci 50: 2614–2620.
25. Chen CY, Keeffe JE, Garoufalis P, et al. (2007) Vision-related quality of life
comparison for emmetropes, myopes after refractive surgery, and myopes
wearing spectacles or contact lenses. J Refract Surg 23: 752–759.
93 Quality of Life and Myopia
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 93
26. Rose K, Harper R, Tromans C, et al. (2000) Quality of life in myopia. Br J
Ophthalmol 84: 1031–1034.
27. Owsley C, McGwin G Jr, Scilley K, et al. (2007) Effect of refractive error
correction on health-related quality of life and depression in older nursing
home residents. Arch Ophthalmol 125: 1471–1477.
28. Broman AT, Munoz B, Rodriguez J, et al. (2002) The impact of visual impair-
ment and eye disease on vision-related quality of life in a Mexican-American
population: proyecto VER. Inv Ophthalmol Vis Sci 43: 3393–3398.
29. Chia EM, Mitchell P, Ojaimi E, et al. (2006) Assessment of vision-related
quality of life in an older population subsample: the Blue Mountains Eye
Study. Ophth Epidemiol 13: 371–377.
30. Lin LL, Shih YF, Hsiao CK, Chen CJ. (2004) Prevalence of myopia in
Taiwanese schoolchildren: 1983 to 2000. Ann Acad Med Singapore 33: 27–33.
31. Wu HM, Seet B, Yap EP, et al. (2001) Does education explain ethnic differ-
ences in myopia prevalence? A population-based study of young adult males
in Singapore. Optom Vis Sci 78: 234–239.
32. Wong TY, Foster PJ, Hee J, et al. (2000) Prevalence and risk factors for
refractive errors in adult Chinese in Singapore. Inv Ophthalmol Vis Sci, 41:
2486–2494.
33. Fisher WP Jr, Eubanks RL, Marier RL. (1997) Equating the MOS SF36 and the
LSU HSI Physical Functioning Scales. J Outcome Measure 1: 329–362.
34. Massof RW. (2002) The measurement of vision disability. Optom Vis Sci 79:
516–552.
35. Pesudovs K. (2006) Patient-centered measurement in ophthalmology — a
paradigm shift. BMC Ophthalmol 6: 25.
36. Wright BD, Linacre JM. (1989) Observations are always ordinal; measure-
ments, however, must be interval. Arch Phys Med Rehab 70: 857–860.
37. Garamendi E, Pesudovs K, Stevens MJ, Elliott DB. (2006) The Refractive
Status and Vision Profile: Evaluation of psychometric properties and
comparison of Rasch and summated Likert-scaling. Vis Res 46: 1375–1383.
38. Norquist JM, Fitzpatrick R, Dawson J, Jenkinson C. (2004) Comparing alter-
native Rasch-based methods vs. raw scores in measuring change in health.
Med Care 42: I25–I36.
39. Pesudovs K, Garamendi E, Elliott DB. (2004) The Quality of Life Impact of
Refractive Correction (QIRC) Questionnaire: development and validation.
Optom Vis Sci 81: 769–777.
40. Seet B, Wong TY, Tan DT, et al. (2001) Myopia in Singapore: taking a public
health approach. Br J Ophthalmol 85: 521–526.
41. Saw SM, Katz J, Schein OD, et al. (1996) Epidemiology of myopia. Epidemiol
Rev 18: 175–187.
94 E.L. Lamoureux and H.-B. Wong
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 94
42. Saw SM, Chan YH, Wong WL, et al. (2008) Prevalence and risk factors for
refractive errors in the Singapore Malay Eye Survey. Ophthalmology 115:
1713–1719.
43. Berry S, Mangione CM, Lindblad AS, McDonnell PJ. (2003) Development
of the National Eye Institute refractive error correction quality of life
questionnaire: Focus groups. Ophthalmology 110: 2285–2291.
95 Quality of Life and Myopia
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 95
b846_Chapter-2.1.qxd 4/8/2010 1:55 AM Page 96
This page intentionally left blank This page intentionally left blank
97
Ocular Morbidity of Pathological Myopia
V. Swetha E. Jeganathan*
,†,‡,§
, Seang-Mei Saw
‡,¶
and Tien-Yin Wong
†,‡
Introduction
The epidemic of myopia is a public health concern, particularly in East
Asia (Singapore, Taiwan, Hong Kong, Japan).
1–4
In Singapore, the preva-
lence of myopia is one of the highest worldwide, affecting 9% to 15% pre-
school children,
5–7
29% primary school children,
8
70% of high school
students,
9
80% in military conscripts,
10,11
and almost 90% of medical stu-
dents.
12
The Tanjong Pagar Survey first suggested that the prevalence of
myopia (< −0.5 D) in Chinese adults 40 years and older was nearly twice the
rates in similarly aged Caucasian populations, including the Melbourne
Visual Impairment Project.
13,14
Furthermore, compared to ethnic Malays,
the Chinese in Singapore have a higher prevalence of myopia (37.8%
versus 33.3%).
13,15
A large proportion of Singaporeans have pathological
myopia (< −6 D), which has been observed across the whole age range
spectrum,
16
including 15% of Singapore’s military conscript population.
11
The prevalence of high myopia is especially significant in parts of East
Asia, with rates of 9–21%, compared with 2–4% in Caucasians.
10
In the
Tanjong Pagar Eye Study, Chinese women had significantly higher rates of
high myopia than men, with bimodal age pattern of myopia, higher
prevalence in the 40 to 49 and 70 to 81 age groups, and lower prevalence
2.2
*Corresponding author. E-mail: [email protected]

Centre for Eye Research Australia, University of Melbourne, Victoria, Australia.

Singapore Eye Research Institute, Yong Loo Lin School of Medicine, National University of Singapore,
Singapore.
§
Tun Hussein Onn National Eye Hospital, Malaysia.

Department of Community, Occupational & Family Medicine, Yong Loo Lin School of Medicine,
National University of Singapore, Singapore.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 97
between those age ranges.
13
In comparison, the prevalence of pathologi-
cal myopia (< −7.9 D) is less than 0.4% in most Western countries.
17
Of particular concern is that the prevalence and severity of myopia has
increased significantly in Singapore over the last two decades across a
whole spectrum of ages.
3
Serial cross-sectional data from the Singapore
Armed Forces, reveal that the prevalence of low vision myopia in military
conscripts aged 18 to 25 years has increased from 26% in the late-1970s, to
43% in the 1980s, 66% in the mid-1990s, and 83% by the late 1990s,
accompanied by a two-fold rise in the proportion with pathological myopia
(< −8 D) from 2% (1993) to 4% (1997).
10,18,19
A similar trend of increasing
myopia prevalence has been observed in schoolchildren.
20
The risk factors
for myopia include higher education, urban residential status, higher
income, professional occupation, and increased near work.
4
However, the
underlying explanation for the worsening trend of myopia prevalence and
severity is poorly understood and is likely complex and multifactorial,
given that East Asian countries with high myopia have similar socio-
economic demographic risk factors as in the West.
21
Pathological myopia is the fourth leading cause of blindness in
Singapore,
22
and may be associated with a myriad of potentially blinding,
irreversible conditions such as retinal detachment and myopic macular
degeneration.
23
Patients with pathological myopia (≤ −10 D) have also
been shown to experience impaired quality of life.
24
Lower utility values in
myopic Singapore high school children are a good example.
25
Despite pre-
vious studies supporting the numerous associations between pathological
myopia and ocular complications,
16
limitations in study design prevent
inference of causality.
Definition of Pathological Myopia
The terms “pathological myopia,” “degenerative myopia,” “malignant
myopia,” or “high myopia” are commonly used interchangeably; however,
there is no standardized definition of pathological myopia to date. Duke
and Elder first defined pathological myopia as myopia accompanied by
degenerative changes in the sclera, choroid, and retinal pigment epithe-
lium, associated with compromised visual function.
26
Tokoro later defined
pathological myopia as myopia caused by excessive and progressive
axial elongation.
27
Some studies have defined pathological myopia as high
myopia (≤ −6 D) and/or axial length of >25.5 mm.
10,18,28
Furthermore,
98 Jeganathan et al.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 98
there is no standardized cut-off for pathological myopia to date.
Common definitions of pathological myopia include spherical equivalent
of at least −6 D, −8 D, or −10 D.
In the Blue Mountains Eye Study (BMES), myopic retinopathy
included the presence of staphyloma, lacquer cracks, Fuch’s spot, and/or
myopic chorioretinal thinning or atrophy.
29
Other signs include
β-peripapillary atrophy, cytotorsion (tilting of the optic disc), and the
T-sign found in central retinal vessels.
30
Shih and co-authors used a grading
system by Avila for myopic macular chorioretinopathy.
31
MO indicated a
normal posterior pole with no tessellation pattern in the macular area;
M1 indicated tessellation and choroidal pallor pattern in the macular
area; M2 indicated choroidal pallor and tessellation, and the border of an
ectasia posteriorly was visualized; M3 indicated pallor and tessellation
with several yellowish lacquer cracks in Bruch’s membrane and posterior
staphyloma; M4 showed choroidal pallor and tessellation, with lacquer
cracks with posterior staphyloma and focal areas of deep choroidal atro-
phy; M5 indicated choroidal pallor and tessellation with lacquer cracks,
posterior staphyloma, geographic areas of atrophy of retinal pigment
epithelium and choroids, and choroidal neovasculariation were visual-
ized. M3 or greater was defined as “with maculopathy.”
32
Jonas graded
peripapillary tessellation from 0 for “no tessellated fundus” to 3 for “very
marked tessellated fundus.”
33
Thus, the systematic grading of fundus pho-
tographs in population-based epidemiologic studies is important in
assessing the prevalence and extent of myopia-associated pathology.
However, there are few grading systems developed for pathologic myopia
that have been consistently used across multiple study populations.
Cataract
The association between pathological myopia and cataract is well
known.
16,34,35
Evidence from epidemiological studies on the relationship
of high myopia and cataract are summarized in Table 1.
15,35–43
Several
population and clinic-based studied have confirmed a strong and consis-
tent association between high myopia and age-related nuclear sclerosis
(NS) in adults aged more than 40 years.
15,39,40–42,44–47
In the Singapore
Malay Eye Study of 3000 Malay adults aged 40 to 80 years, there was a
U-shaped relationship between increasing age and the prevalence of
myopia, which was partially explained by the age-related increase in the
99 Ocular Morbidity of Pathological Myopia
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 99
1
0
0
J
e
g
a
n
a
t
h
a
n

e
t

a
l
.

Table 1. Summary of Published Data on Myopia and Cataract
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
Brown 1987 Oxford, CCS 220 ≥ 40 SR Lens Excluded high Crude OR of myopia = 1.06
and Hill
35
United photography myopia 95% CI (0.6, 1.9).
Kingdom (cataract) (−12 D)
Lim et al.; 1999 Sydney, PBCS 7308 49–97 AR and SR High myopia OR of cataract prevalence,
Blue Australia Lens (≤ −6 D) adjusted for age, sex, smoking,
Mountains Photography hypertension, diabetes, steroids,
Eye Study
36
sun related skin damage:
PSC = 4.9 (2.1, 11.4)
CC = 2.9 (1.4, 6.0)
NS = 1.4 (0.8, 2.4).
McCarthy 1999 Melbourne, PSC 5147 ≥ 40 AR Lens ≤ −1 D OR of cataract prevalence:
et al.; Australia photography PSC = 3.59 (2.5, 5.15),
Visual (cataract) adjusted for age, rural,
Impairment diuretics, vitamins A and E,
Project
37
ultraviolet light; CC = 1.76
(1.3, 2.4), adjusted for age,
gender, iris, arthritis, diabetes,
gout, beta-blockers, ultraviolet
light, glaucoma NS = 2.73
(1.9, 3.92), adjusted for age,
gender, diabetes, smoking and
education.
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
0
1
0
1
O
c
u
l
a
r

M
o
r
b
i
d
i
t
y

o
f

P
a
t
h
o
l
o
g
i
c
a
l

M
y
o
p
i
a
Table 1. (Continued)
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
Wu et al.; 1999 Barbados PBCS 4036 40–84 AR ≤ −0.5 D A higher prevalence of
Barbados myopia was positively
Eye Study
38
associated (P < 0.05) with
NS, PSC, glaucoma, and
ocular hypertension.
Dandona et al.; 1999 Hyderabad, PBCS 2321 ≥16 AR ≤ −0.75 D With multivariate analysis,
the Andhra India myopia was higher in
Pradesh Eye subjects with NS ≥ 3.5
Disease Study
39
(OR 9.10; 95% CI,
5.15–16.09), and those
with education of class
11 or higher (OR 1.80; 95%
CI, 1.18–2.74).
Wong et al.; 2001 USA PBCS 4470 43–84 AR (baseline); ≤ −1 D Myopia not associated with
Beaver Dam Lens incident cataract. OR of
Eye Study photography prevalent cataract for
(FU = 5 years)
40
(prevalent myopia, adjusted for age,
cataract at gender, diabetes, smoking,
baseline and education: PSC = 1.23
incident (0.75, 2.03) CC = 0.86
cataract at (0.64, 1.16) NS = 1.74
5 years) (1.28, 2.37).
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
1
1
0
2
J
e
g
a
n
a
t
h
a
n

e
t

a
l
.

Table 1. (Continued)
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
Younan et al.; 2002 Sydney, PBCS 2334 ≥ 49 AR and SR ≤ −3.5 D OR of incident cataract:
Blue Mountains Australia (baseline); PSC = 4.4 (1.7, 11.5)
Eye Study Lens adjusted for age, sex,
(FU = 5 years)
41
photography education, obesity,
(cataract at hypertension, NS.
5 years) ≤ −6.0 D CC = 0.5 (0.2, 2.0), adjusted for
age, sex, education, alcohol,
uv light, diabetes, obesity,
stroke, NS.
≤ −6.0 D NS = 3.3 (1.5, 7.4) adjusted for
age, sex, smoking, education,
iris, inhaled steroids.
Incident cataract surgery was
significantly associated with
any myopia (OR 2.1, 95%
CI 1.1–4.2), as well as
moderate (−3.5 to more than
−6 D; OR 2.9, 1.2–7.3) and
high myopia (OR 3.4, 95%
CI 1.0–11.3).
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
2
1
0
3
O
c
u
l
a
r

M
o
r
b
i
d
i
t
y

o
f

P
a
t
h
o
l
o
g
i
c
a
l

M
y
o
p
i
a
Table 1. (Continued)
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
Wong et al.; 2003 Singapore PBCS 1232 40–81 SR, if −1.35 D vs Adjusted for age, gender,
Tanjong unavailable −0.11 D education, diabetes, and
Pagar Survey
42
AR −1.80 D vs smoking. NS was associated
−0.39 D with myopia (p < 0.001);
PSC was associated with
myopia (p < 0.001).
Adjustment for vitreous
chamber depth attenuated
the association between PSC
(not NS) and myopia by
65.5%.
Chang et al.; 2005 Salisbury, PBCS 2520 65–84 AR OR for incident cataract:
Salisbury Eye United −0.50 D and NS = 2.25 (P < 0.001)
Evaluation Kingdom −1.99 D
Project
43
−2.00 D and NS = 3.65 (P < 0.001)
−3.99 D
−4.00 D and NS = 4.54 (P < 0.001)
−5.99 D
−6.00 D or NS = 3.61 (P = 0.002)
more
−0.50 D and PSC = 1.59 (P = 0.11),
−1.99 D
−2.00 D and PSC = 3.22 (P = 0.002)
−3.99 D
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
3
1
0
4
J
e
g
a
n
a
t
h
a
n

e
t

a
l
.

Table 1. (Continued)
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
−4.00 D and PSC = 5.36 (P < 0.001),
−5.99 D
−6.00 D or PSC = 12.34 (P < 0.001).
more No association was found
between myopia and CC.
Saw et al.; 2008 Singapore PBCS 2974 40–80 SR, if ≤ −0.5 D In a multiple logistic regression
Singapore unavailable- model, female sex, age, higher
Malay Eye AR educational level, and cataract
Study
15
were associated with myopia.
AR: autorefraction, CI: confidence interval, CC: cortical cataract, CCS: case control study, D: dioptres, NS: nuclear sclerosis, OR: odds ratio, PBSC: popula-
tion-based cross-sectional study, PSC: posterior subcapsular cataract, SR: subjective refraction.
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
4
prevalence of cataract, increasing density of lens nucleus with age, caus-
ing a myopic shift in refraction (i.e. index myopia).
15
The Tanjong Pagar
Survey of 1200 Chinese adults aged 40 to 80 years further supports this
hypothesis; NS was associated with myopia (p < 0.001) without any
change to axial length or the biometric components.
43
In the BMES of
Caucasian adults, there was a statistically significant association between
high myopia (≤ −6 D) and incident NS.
41
A myopic refractive shift
occurred in persons with NS levels 4 or higher, attesting the contribution
of NS to the mild myopic shift that neutralizes the age-related hyperopic
shift occurring in older persons.
48
Furthermore, according to the Beaver
Dam Eye Study (BDES) five-year follow up, much of the myopic change
after the age of 70 may be attributed to increasing NS.
40
The NS is
often missed because any increase in refraction is generally attributed to
an increase in the pathological myopia. Oxidative lens damage is known
to occur early in myopic eyes.
49
Furthermore, it is unknown whether
myopia is a risk factor for NS because NS is known to affect refraction
and cause myopia.
The relationship between myopia and posterior subcapsular cataract
(PSC) is controversial. In BMES, incident PSC was associated with
the presence of myopia (OR 2.1, 95% CI 1.0–4.8), moderate to high
myopia (−3.5 D or less, OR 4.4, 95% CI 1.7–11.5).
41
Moreover, eyes with
the onset of myopia before age 20 years had the greatest risk of PSC (OR
3.9; CI 2.0–7.9), suggesting the possibility of a dose response between
the levels of myopia and PSC.
36
The Tanjong Pagar Survey showed that
PSC was related to deeper anterior chamber, thinner lens, and longer
vitreous chamber; and adjusting for these components, especially vitre-
ous chamber depth, attenuated the association of myopia significantly,
suggesting that the refractive association of this form of cataract was
axial.
50
As PSC does not appreciably affect refraction, it was suggested
that the relationship between PSC and myopia is causal i.e. myopia may
be a risk factor for the development of PSC. In contrast, cortical cataract
was not related to myopia, either cross-sectionally or longitudinally in
these studies.
15,39,40–42,44–47
Incident cataract surgery was significantly associated with myopia,
(OR 2.1, 95% CI 1.1–4.2) as well as moderate (−3.5 to more than −6 D;
OR 2.9, 1.2–7.3) and high myopia (OR 3.4, 95% CI 1.0–11.3).
41
The BDES
found an association between myopia and five-year risk of cataract sur-
gery; most likely due to the presence of PSC, which is known to be the
most important lens opacity predicting the need for cataract surgery.
41
105 Ocular Morbidity of Pathological Myopia
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 105
Cataract extraction in high myopia must be considered carefully because
patients with high myopia are at increased risk of retinal breaks and
retinal detachment.
51,52
Glaucoma
An association between high myopia and primary open angle glaucoma
(POAG) has been supported by numerous case series, case control, and
large population-based studies (Table 2).
38,53–61,63
The prevalence of
myopia with POAG is 4% and may increase to 6–7% with higher degrees
of myopia.
62
In the BMES, after adjusting for age, gender and other risk
factors, glaucoma was two to three times as frequent as eyes with myopia
compared with eyes with emmetropia or hyperopia.
55
In the Barbados Eye
Study, a myopic refraction was one of several risk factors in adult black
people with prevalent POAG.
38,63
Both the BMES and Barbados Eye Study
confirm a dose-response between the level of myopia and prevalence of
glaucoma.
38,55,63
Severe myopia (< − 4D), not mild myopia, has been
shown to be a significant risk factor for subsequent visual field loss in
patients with POAG.
64
However, in the Ocular Hypertension Treatment
Study, high myopia was not predictive of POAG.
65
Moreover, individuals
with myopia were not found to have a higher incidence or progression of
glaucoma in the Ocular Hypertension Treatment Study or Early Manifest
Glaucoma Trial.
65,66
High myopia is related with higher intraocular
pressure (IOP) and occurs more often in glaucoma patients than in the
normal population, particularly amongst the elderly.
55
In POAG patients
with high IOP, higher myopia is thought to be a factor that threatens their
quality of life.
67
Interestingly, the visual field of myopic eyes more often
improves and less often worsens once the IOP has been lowered thera-
peutically. There is now evidence that myopia is a risk factor for the devel-
opment of ocular hypertension, based on data of the screening
examination for the Early Manifest Glaucoma Trial and other studies.
68–70
Structural changes associated with myopia, such as longer axial length,
larger and/or tilted optic disc, thinner lamina cribrosa, peripapillary
atrophy, and shared alteration in collagen and other extracellular matrix
of the optic nerve is postulated to make the upper maculopapillary
bundle (lower cecofield) more susceptible to glaucomatous injury.
67
Highly myopic patients are also at higher risk of postoperative hypotony
maculopathy.
71
106 Jeganathan et al.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 106
1
0
7
O
c
u
l
a
r

M
o
r
b
i
d
i
t
y

o
f

P
a
t
h
o
l
o
g
i
c
a
l

M
y
o
p
i
a
Table 2. Summary of Published Data on Myopia and Glaucoma
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
Daubs and 1981 London, CCS 953 ≥ 40 SR OAG-eyes High myopia OR of OAG = 3.1 (95% CI 1.6,
Crick
53
United with open (≤ −5 D) 5.8) OR of OAG = 1.3
Kingdom angles and Low myopia (1.0, 1.8). Adjusted for age,
VFD (−0.25 D to IOP, sex, family history, blood
−5 D) pressure, astigmatism, season,
health.
Ponte et al.; 1994 Italy PBCS 264 ≥ 40 Cases: IOP ≥ 24, ≤ −0.5 D OR of glaucoma prevalence =
Casteldaccia history of 5.56 (1.85, 16.67). Adjusted for
Eye Study
54
glaucoma, diabetes, hypertension,
VFD. Controls: steroids, iris texture.
IOP ≤20,
CDR 0–0.2
Mitchell et al; 1999 Sydney, PBCS 3654 ≥ 49 AR and SR OAG High myopia OR of OAG prevalence =
Blue Australia defined as ≤ −3 D 3.3 (1.7, 6.4) OR of OAG
Mountains CDR ≥0.7 or Low myopia prevalence = 2.3 (1.3, 4.1).
Eye Study
55
CD asymmetry (−3 D to Adjusted for gender, family
≥0.3 ≥ −1 D) history, diabetes, hypertension,
migraine, steroid use,
psedoexfoliation.
Wu et al; 1999 Barbados PBSC 4709 40–84 AR OAG-eyes ≤ −0.5 D OR of OAG prevalence =
Barbados with open 1.48 (1.12,1.95).
Eye Study
38
angles and VFD
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
7
1
0
8
J
e
g
a
n
a
t
h
a
n

e
t

a
l
.

Table 2. (Continued)
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
Grodum et al.
56
2001 Malmo, PBCS 32,918 57–79 AR OAG defined ≤ −1 D Prevalence of newly diagnosed
Sweden as 2 repeatable OAG increased with increasing
VFD myopia (p < 0.01), and 1.5%
in moderate to high myopia.
Adjusted for age, gender, IOP.
Yoshida et al.
57
2001 Yokohama, CCS 64,394 ≥ 49 AR POAG defined ≤ −3 D Prevalence of POAG is higher in
Japan as glaucomatous moderate to high myopes
VFD associated (p < 0.001).
with abnormal
optic disc
and/or disc
margin
Wong et al; 2003 Wisconsin, PBCS 4670 43–86 AR and SR POAG ≤ −1 D OR of prevalent POAG for
Beaver Dam USA defined as myopia = 1.6 (1.1, 2.3).
Eye Study
58
IOP ≥ 22, Adjusted for age and gender.
CDR ≥ 0.8, VFD,
history of
glaucoma
treatment
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
8
1
0
9
O
c
u
l
a
r

M
o
r
b
i
d
i
t
y

o
f

P
a
t
h
o
l
o
g
i
c
a
l

M
y
o
p
i
a
Table 2. (Continued)
Study Sample Age Definition of Summary of Main
Source Year Place Design Size (n) (Years) Methodology Myopia Findings
Suzuki et al; 2006 Tajimi, PBCS 119 ≥ 40 AR POAG Low myopia OR of prevalent POAG =
Tajimi Japan diagnosed from (−3 D to −1 D) 1.85 (1.03, 3.31) for low
Eye Study
59
IOP, CDR, Moderate to myopia and 2.60 (1.56, 4.35)
and VFD high myopia for moderate to high myopia.
(≤ −3 D) Adjusted for age, gender, IOP,
corneal curvature, central
corneal thickness, diabetes,
migraine, hypertension,
smoking, family history of
glaucoma.
Xu. et al; 2007 Beijing, PBCS 4439 ≥ 40 AR and SR High myopia OR of prevalent POAG in highly
Beijing China POAG diagnosed (> −8 D) myopic marked myopia =
Eye Study
60
from CDR Marked myopia 2.28 (0.99, 5.25) compared to
(photos) and (< −6 D to −8 D) moderate myopia. The OR was
IOP Moderate myopia significantly higher than in
(< −3 D to −6 D) the group with low myopia
(OR 3.5; 1.71, 7.25).
Casson, et al; 2007 Meiktila, PBCS 2076 ≥ 40 AR POAG Myopia < 0.5 D Myopia (P = 0.049), increasing
Meiktila Burma diagnosed from age, and IOP (P < 0.001) were
Eye Study
61
IOP, CDR, and significant risk factors for
VFD POAG.
AR: autorefraction, CDR: cup-disc ratio, CI: confidence interval, CCS: case control study, D: dioptres, IOP: intraocular pressure, OR: odds ratio, PBSC: pop-
ulation-based cross-sectional study, POAG: primary open angle glaucoma, SR: subjective refraction, VFD: visual field defect.
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
2
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
6

A
M


P
a
g
e

1
0
9
Myopic Maculopathy
Several population-based studies have not found an association between
myopia and AMD.
72,73
In contrast, the Beijing Eye Study showed that highly
myopic eyes had a significant lower prevalence of early and late AMD,
compared to non-highly myopic eyes.
74
Macular choroidal neovascularisa-
tion (CNV) is the most common vision-threatening complication of high
myopia,
24
especially in persons younger than 50 years.
75,76
The impact of
myopic degeneration on visual impairment is important, because it is
often bilateral, irreversible, and affects individuals during their productive
years.
77
Several studies report a prevalence of myopic degeneration at about 1%
in the general population in Asia.
78
Clinical and histopathological studies
have documented CNV in 5% to 10% of eyes with axial length of over
26.5mm.
33
CNV has been reported to develop in 12.5% of patients with
high myopia after cataract surgery.
79
Among myopic patients with pre-
existing CNV, more than 30% develop CNV in the fellow eye within eight
years.
31
Myopic degeneration may occur independently of the scleral
conus, or it may be caused by enlargement of the temporal conus, involv-
ing the macular region. In highly myopic eyes, the Forster-Fuchs’ spot at
the macula forms due to the proliferation of pigment epithelium and
deposition of blood pigment following choroidal haemorrhage from the
neovascular tissue.
80
The Forster–Fuchs’ spot has been found in 3.2% to
20% of patients identified with pathological myopia, predominantly in mid-
dle age.
28,81
Myopic CNV is considered to have a limited course, in contrast
to CNV secondary to AMD.
31
Some studies report a favorable visual acuity
outcome of myopic CNV,
31,82
while others report a poorer prognosis.
83–85
Imaging modalities including OCT, angiography, and fundus autofluores-
cence have provided further insights into the in vivo pathology of myopic
CNV.
86
Therapeutic interventions to date include laser photocoagulation
and pharmacologic agents, such as steroids and anti-angiogenic drugs.
Myopic Retinopathy
Myopic retinopathy refers to a cluster of signs that indicate degeneration
of the chorioretinal tissues associated with the excessive axial elongation of
the myopic eye, leading to mechanical stretching and thinning of the
choroid and retinal pigment epithelium with concomitant vascular and
110 Jeganathan et al.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 110
degenerative changes.
28,87
Posterior pole changes include posterior staphy-
loma, lacquer cracks, Fuchs’ spot, and chorioretinal atrophy.
29,88
Peripheral
retinal features of myopic retinopathy include lattice, paving stone, white-
without-pressure, and pigmentary degenerations, as well as retinal tears.
87,88
In BMES, progression of myopic retinopathy was observed in 17.4% of
eyes after five years.
29
Posterior pole staphyloma has been reported to be
the most common type of staphyloma.
89
Lacquer cracks or ruptures in the
retinal pigment epithelium-Bruch’s membrane-choriocapillaris complex
have been reported in patients with high myopia.
90
The prevalence of lac-
quer cracks has ranged from 0.2% to 9.2% in highly myopic popula-
tions,
28,81
and may characterize an unfavorable prognosis in patients with
pathologic myopia.
91
In studies by Pierro et al. and Gozum et al., it was
found that longer axial length was associated with increased prevalence
of lattice degeneration, pavingstone degeneration, and white-without-
pressure.
87,92
Chorioretinal atrophy occurs in the late stage of myopic
degeneration.
16
Macular hole formation is an important complication of
highly myopic eyes, and it is frequently complicated by macular hole reti-
nal detachment.
93–95
Studies by Azzolini and Benhamou correlated the bio-
microscopic signs of early macular holes (e.g. microcystic appearance,
macular striae) with the presence of foveal retinoschisis, as well as pre-
foveal tractional membranes on OCT images.
96,97
Retinal Detachment
Retinal breaks and retinal detachment (RD) occur more frequently in eyes
with increased axial length as a result of lattice degeneration, increased
frequency of posterior vitreous detachment, or macular hole formation.
98
Round and multiple retinal breaks characterize myopic retinal detach-
ment. The yearly incidence of retinal detachments has been estimated as
0.015% in patients with less than 4.75 D myopia, increases to 0.07% in
patients with ≥5 D myopia and 3.2% in patients’ ≥6 D myopia.
99,100
Posterior vitreous detachment tends to occur at an earlier age, in high
myopes.
101
The prevalence of posterior vitreous detachment was 12.5% in
a case series of patients with high myopia, and 60.7% in patients with axial
length >30mm.
101
Up to 6.3% of highly myopic eyes are reported to
develop asymptomatic macular holes, confirmed by ocular coherence
tomography.
102,103
Macular holes in patients with pathological myopia are
caused by traction effects of firm vitreoretinal adhesions.
104
Consequently,
111 Ocular Morbidity of Pathological Myopia
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 111
macular holes occur more frequently in highly myopic eyes with advanced
posterior staphyloma. Symptomatic retinal tears, or subclinical RD, should
be treated.
105,106
Asymptomatic lattice degenerations generally do not
require prophylactic treatment with absence of other risk factors.
107
High
myopia also predisposes eyes to RD after cataract surgery, such as phaco-
emulsification.
52,108
Axial length, in addition to myopic pathology, is a
factor associated with such retinal detachments.
108
Scleral ectasia can make
surgical repair of such detachment more difficult as well.
109
Optic Disc Abnormalities
Globe elongation in myopia and the resulting posterior staphyloma leads
to characteristic optic nerve changes, such as increased size and the tilted
shape of the optic disc, as well as larger cup-to-disc ratio (CDR).
110
The
greater the axial length of the eye, the higher the CDR.
111
The majority of
patients with tilted discs are reported to have a visual field defect
112,113
;
however, in other studies these field defects are not consistently found.
114
Previous studies on persons with more severe myopia showed a greater
prevalence of complications; and increased peripapillary atrophy with
increasing severity of myopia.
110,115
Thinning of the retina and RPE leads
to the peripapillary thinning crescent observed to surround the optic disc.
No myopic crescent was present if the axial length was 21 mm, 75% eyes
had myopic crescents if the axial length was 25 mm to 29 mm, and 100%
of the eyes had myopic crescents if the axial length was more than
29 mm.
116
Peripapillary detachment, an elevated, yellow–orange lesion
inferior to the optic disc, is also seen in highly myopic eyes.
117
Peripapillary
detachment was present in 4.9% of highly myopic eyes and was associated
with glaucomatous optic nerve defects in 71% of eyes.
117
Glaucoma is dif-
ficult to diagnose in high myopia because of the position of the lamina
cribrosa and resulting cupping. Moreover, arcuate visual field defects may
be secondary to retinochoroidal degenerations.
Conclusion
As pathological myopia is among the leading causes of legal blindness,
the detection and treatment of potential complications are vital in
high-risk subjects. The prevalence of myopia, subsequent high myopia, and
112 Jeganathan et al.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 112
113 Ocular Morbidity of Pathological Myopia
associated pathology is rising in several countries. Thus, it is important
to prevent a possible rise in blindness due to the myopia epidemic.
Furthermore, refractive surgical procedures such as laser in situ ker-
atomileusis (LASIK) and photorefractive keratectomy (PRK) have achieved
emmetropia in high myopes, but do not eliminate the myriad of posterior
segment complications that are potentially incapacitating. Given that the
ocular morbidity of myopia may constitute an important clinical, public
health, and economic problem, an integrated, pragmatic public health
approach with community-based eye screening and research programs, as
well as correcting myopia and retarding myopia progression are important.
The early detection and management of degenerative eye diseases is central
in the care of myopic adults in the prevention of visual impairment and
blindness. The prevalence of pathologic myopia is expected to increase
with ageing populations and with time due to the cohort effect. Myopic
degeneration, macular holes, and retinal detachment are lesions that are
potentially blinding. If the risks of pathologic myopia are proportional
to the severity of myopia, measures to prevent the early onset and rapid
progression of myopia in childhood will eliminate or reduce pathologic
myopia later in life.
References
1. Seet B, Wong TY, Tan DT, et al. (2001) Myopia in Singapore: Taking a public
health approach. Br J Ophthalmol 85(5): 521–526.
2. Saw SM. (2003) A synopsis of the prevalence rates and environmental risk
factors for myopia. Clin Exp Optom 86(5): 289–294.
3. Saw SM, Wong TY. (2004) Evidence for an epidemic of myopia. Letter to
editor. Ann Acad Med Singapore 33: 544.
4. Saw SM, Katz J, Schein OD, et al. (1996) Epidemiology of myopia. Epidemiol
Rev 18(2): 175–187.
5. Saw SM, Chan B, Seenyen L, et al. (2001) Myopia in Singapore kindergarten
children. Optometry 72(5): 286–291.
6. Tan GJ, Ng YP, Lim YC, et al. (2000) Cross-sectional study of near-work and
myopia in kindergarten children in Singapore. Ann Acad Med Singapore
29(6): 740–744.
7. Lim HC, Quah BL, Balakrishnan V, et al. (2000) Vision screening of four-
year-old children in Singapore. Singapore Med J 41(6): 271–278.
8. Rose KA, Morgan IG, Smith W, et al. (2008) Myopia, lifestyle, and schooling
in students of Chinese ethnicity in Singapore and Sydney. Arch Ophthalmol
126(4): 527–530.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 113
9. Quek TP, Chua CG, Chong CS, et al. (2004) Prevalence of refractive errors
in teenage high school students in Singapore. Ophthalmic Physiol Opt 24(1):
47–55.
10. Wu HM, Seet B, Yap EP, et al. (2001) Does education explain ethnic differ-
ences in myopia prevalence? A population-based study of young adult males
in Singapore. Optom Vis Sci 78(4): 234–239.
11. Saw SM, Wu HM, Seet B, et al. (2001) Academic achievement, close up work
parameters, and myopia in Singapore military conscripts. Br J Ophthalmol
85(7): 855–860.
12. Woo WW, Lim KA, Yang H, et al. (2004) Refractive errors in medical
students in Singapore. Singapore Med J 45(10): 470–474.
13. Wong TY, Foster PJ, Hee J, et al. (2000) Prevalence and risk factors for refrac-
tive errors in adult Chinese in Singapore. Invest Ophthalmol Vis Sci 41(9):
2486–2494.
14. Wensor M, McCarty CA, Taylor HR. (1999) Prevalence and risk factors of
myopia in Victoria, Australia. Arch Ophthalmol 117(5): 658–663.
15. Saw SM, Chan YH, Wong WL, et al. (2008) Prevalence and risk factors for
refractive errors in the Singapore Malay Eye Survey. Ophthalmology 115(10):
1713–1719. Epub 2008, May 16.
16. Saw SM, Gazzard G, Shih-Yen EC, Chua WH. (2005) Myopia and associated
pathological complications. Ophthalmic Physiol Opt. 25(5): 381–391.
17. Sperduto RD, Seigel D, Roberts J, Rowland M. (1983) Prevalence of myopia
in the United States. Arch Ophthalmol 101(3): 405–407.
18. Chew SJ, Chia SC, Lee LK. (1988) The pattern of myopia in young
Singaporean men. Singapore Med J 29(3): 201–211.
19. Au Eong KG, Tay TH, Lim MK. (1993) Race, culture and Myopia in 110,236
young Singaporean males. Singapore Med J 34(1): 29–32.
20. Tan NW, Saw SM, Lam DS, et al. (2000) Temporal variations in myopia pro-
gression in Singaporean children within an academic year. Optom Vis Sci
77(9): 465–472.
21. Saw SM, Chua WH, Wu HM, et al. (2000) Myopia: Gene-environment inter-
action. Ann Acad Med Singapore 29(3): 290–297.
22. Wong TY, Saw SM. (2004) Issues and challenges for myopia research. Ann
Acad Med Singapore 33(1): 1–3.
23. Tano Y. (2002) Pathologic myopia: where are we now? Am J Ophthalmol
134(5): 645–660.
24. Rose K, Harper R, Tromans C, et al. (2000) Quality of life in myopia.
Br J Ophthalmol 84(9): 1031–1034.
25. Saw SM, Gazzard G, Au Eong KG, Koh D. (2003) Utility values and myopia
in teenage school students. Br J Ophthalmol 87(3): 341–345.
26. Duke-Elder S. (1970) Pathological Refractive Errors. Duke-Elder S, ed.
St. Louis: Mosby.
114 Jeganathan et al.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 114
115 Ocular Morbidity of Pathological Myopia
27. Tokoro T. (1988) On the definition of pathologic myopia in group studies.
Acta Ophthalmol Suppl 185: 107–108.
28. Grossniklaus HE, Green WR. (1992) Pathologic findings in pathologic
myopia. Retina 12(2): 127–133.
29. Vongphanit J, Mitchell P, Wang JJ. (2002) Prevalence and progression of
myopic retinopathy in an older population. Ophthalmology 109(4):
704–711.
30. Curtin BJ, Karlin DB. (1970) Axial length measurements and fundus changes
of the myopic eye. I. The posterior fundus. Trans Am Ophthalmology Soc 68:
312–334.
31. Avila MP, Weiter JJ, Jalkh AE, et al. (1984) Natural history of choroidal
neovascularization in degenerative myopia. Ophthalmology 91(12):
1573–1581.
32. Shih YF, Ho TC, Hsiao CK, Lin LL. (2006) Visual outcomes for high myopic
patients with or without myopic maculopathy: a 10-year follow-up study.
Br J Ophthalmol 90(5): 546–550.
33. Jonas JB, Dichtl A. (1997) Optic disc morphology in myopic primary open-
angle glaucoma. Graefes Arch Clin Exp Ophthalmol 235(10): 627–633.
34. Reeves BC, Hill AR, Brown NA. (1987) Myopia and cataract. Lancet 24;
2(8565): 964.
35. Brown NA, Hill AR. (1987) Cataract: The relation between myopia and
cataract morphology. Br J Ophthalmol 71(6): 405–414.
36. Lim R, Mitchell P, Cumming RG. (1999) Refractive associations with
cataract: The Blue Mountains Eye Study. Invest Ophthalmol Vis Sci 40(12):
3021–3026.
37. McCarty CA, Mukesh BN, Fu CL, Taylor HR. (1999) The epidemiology of
cataract in Australia. Am J Ophthalmol 128(4): 446–465.
38. Wu SY, Nemesure B, Leske MC. (1999) Refractive errors in a black adult
population: The Barbados Eye Study. Invest Ophthalmol Vis Sci 40(10):
2179–2184.
39. Dandona R, Dandona L, Naduvilath TJ, et al. (1999) Refractive errors in an
urban population in Southern India: the Andhra Pradesh Eye Disease
Study. Invest Ophthalmol Vis Sci 40(12): 2810–2818.
40. Wong TY, Klein BE, Klein R, et al. (2001) Refractive errors and incident
cataracts: the Beaver Dam Eye Study. Invest Ophthalmol Vis Sci 42(7):
1449–1454.
41. Younan C, Mitchell P, Cumming RG, et al. (2002) Myopia and incident
cataract and cataract surgery: the Blue Mountains Eye Study. Invest
Ophthalmol Vis Sci 43(12): 3625–3632.
42. Wong TY, Foster PJ, Johnson GJ, Seah SK. (2003) Refractive errors, axial
ocular dimensions, and age-related cataracts: the Tanjong Pagar survey.
Invest Ophthalmol Vis Sci 44(4): 1479–1485.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 115
116 Jeganathan et al.
43. Chang MA, Congdon NG, Bykhovskaya I, et al. (2005) The association
between myopia and various subtypes of lens opacity: SEE (Salisbury Eye
Evaluation) project. Ophthalmology 112(8): 1395–1401.
44. Wensor M, McCarty CA, Taylor HR. (1999) Prevalence and risk factors of
myopia in Victoria, Australia. Arch Ophthalmol 117(5): 658–663.
45. Praveen MR, Vasavada AR, Jani UD, et al. (2008) Prevalence of cataract type
in relation to axial length in subjects with high myopia and emmetropia in
an Indian population. Am J Ophthalmol 145(1): 176–181.
46. Gupta A, Casson RJ, Newland HS, et al. (2008) Prevalence of refractive
error in rural Myanmar: the Meiktila Eye Study. Ophthalmology 115(1):
26–32.
47. Xu L, Li J, Cui T, et al. (2005) Refractive error in urban and rural adult
Chinese in Beijing. Ophthalmology 112(10): 1676–1683.
48. Panchapakesan J, Rochtchina E, Mitchell P. (2003) Myopic refractive shift
caused by incident cataract: the Blue Mountains Eye Study. Ophthalmic
Epidemiol 10(4): 241–247.
49. Spector A. (1995) Oxidative stress-induced cataract: Mechanism of action.
Faseb J 9(12): 1173–1182.
50. Foster PJ, Wong TY, Machin D, et al. (2003) Risk factors for nuclear, cortical
and posterior subcapsular cataracts in the Chinese population of Singapore:
the Tanjong Pagar Survey. Br J Ophthalmol 87(9): 1112–1120.
51. Fan DS, Lam DS, Li KK. (1999) Retinal complications after cataract
extraction in patients with high myopia. Ophthalmology 106(4): 688–691;
discussion 91–92.
52. Lois N, Wong D. (2003) Pseudophakic retinal detachment. Surv Ophthalmol
48(5): 467–487.
53. Daubs JG, Crick RP. (1981) Effect of refractive error on the risk of ocular
hypertension and open angle glaucoma. Trans Ophthalmol Soc UK 101(1):
121–126.
54. Ponte F, Giuffre G, Giammanco R, Dardanoni G. (1994) Risk factors of
ocular hypertension and glaucoma. The Casteldaccia Eye Study. Doc
Ophthalmol 85(3): 203–210.
55. Mitchell P, Hourihan F, Sandbach J, Wang JJ. (1999) The relationship between
glaucoma and myopia: the Blue Mountains Eye Study. Ophthalmology
106(10): 2010–2015.
56. Grodum K, Heijl A, Bengtsson B. (2001) Refractive error and glaucoma. Acta
Ophthalmol Scand 79(6): 560–566.
57. Yoshida M, Okada E, Mizuki N, et al. (2001) Age-specific prevalence
of open-angle glaucoma and its relationship to refraction among more
than 60,000 asymptomatic Japanese subjects. J Clin Epidemiol 54(11):
1151–1158.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 116
117 Ocular Morbidity of Pathological Myopia
58. Wong TY, Klein BE, Klein R, et al. (2003) Refractive errors, intraocular
pressure, and glaucoma in a white population. Ophthalmology 110(1):
211–217.
59. Suzuki Y, Iwase A, Araie M, et al. (2006) Risk factors for open-angle glau-
coma in a Japanese population: the Tajimi Study. Ophthalmology 113(9):
1613–1617.
60. Xu L, Wang Y, Wang S, et al. (2007) High myopia and glaucoma susceptibil-
ity the Beijing Eye Study. Ophthalmology 114(2): 216–220.
61. Casson RJ, Gupta A, Newland HS, et al. (2007) Risk factors for primary
open-angle glaucoma in a Burmese population: the Meiktila Eye Study. Clin
Experiment Ophthalmol 35(8): 739–744.
62. Mastropasqua L, Lobefalo L, Mancini A, et al. (1992) Prevalence of myopia
in open angle glaucoma. Eur J Ophthalmol 2(1): 33–35.
63. Wu SY, Nemesure B, Leske MC. (2000) Glaucoma and myopia.
Ophthalmology 107(6): 1026–1027.
64. Chihara E, Liu X, Dong J, et al. (1997) Severe myopia as a risk factor for pro-
gressive visual field loss in primary open-angle glaucoma. Ophthalmologica
211(2): 66–71.
65. Parrish RK, 2nd. (2006) The European Glaucoma Prevention Study and the
Ocular Hypertension Treatment Study: why do two studies have different
results? Curr Opin Ophthalmol 17(2): 138–141.
66. Leske MC, Heijl A, Hyman L, et al. (2007) Predictors of long-term
progression in the early manifest glaucoma trial. Ophthalmology 114(11):
1965–1972.
67. Faschinger C, Mossbock G. (2007) [Myopia and glaucoma]. Wien Med
Wochenschr 157(7–8): 173–177.
68. Seddon JM, Schwartz B, Flowerdew G. (1983) Case-control study of ocular
hypertension. Arch Ophthalmol 101(6): 891–894.
69. David R, Zangwill LM, Tessler Z, Yassur Y. (1985) The correlation between
intraocular pressure and refractive status. Arch Ophthalmol 103(12):
1812–1815.
70. Arend KO, Redbrake C. (2005) [Update on prospective glaucoma interven-
tion studies]. Klin Monatsbl Augenheilkd 222(10): 807–813.
71. Gavrilova B, Roters S, Engels BF, et al. (2004) Late hypotony as a complica-
tion of viscocanalostomy: a case report. J Glaucoma 13(4): 263–267.
72. Wong TY, Klein R, Klein BE, Tomany SC. (2002) Refractive errors and
10-year incidence of age-related maculopathy. Invest Ophthalmol Vis Sci
43(9): 2869–2873.
73. Wang JJ, Mitchell P, Smith W. (1998) Refractive error and age-related
maculopathy: the Blue Mountains Eye Study. Invest Ophthalmol Vis Sci
39(11): 2167–2171.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 117
74. Xu L, Wang Y, Li Y, et al. (2006) Causes of blindness and visual impairment
in urban and rural areas in Beijing: the Beijing Eye Study. Ophthalmology
113(7): 1134 e1–e11.
75. Derosa JT, Yannuzzi LA, Marmor M, et al. (1995) Risk factors for choroidal
neovascularization in young patients: a case-control study. Doc Ophthalmol
91(3): 207–222.
76. Cohen SY, Laroche A, Leguen Y, et al. (1996) Etiology of choroidal neovas-
cularization in young patients. Ophthalmology 103(8): 1241–1244.
77. Lai TY, Fan DS, Lai WW, Lam DS. (2008) Peripheral and posterior pole retinal
lesions in association with high myopia: a cross-sectional community-based
study in Hong Kong. Eye 22(2): 209–213.
78. Tsai IL, Woung LC, Tsai CY, et al. (2008) Trends in blind and low vision reg-
istrations in Taipei City. Eur J Ophthalmol 18(1): 118–124.
79. Hayashi K, Ohno-Matsui K, Futagami S, et al. (2006) Choroidal neovascu-
larization in highly myopic eyes after cataract surgery. Jpn J Ophthalmol
50(4): 345–348.
80. Hampton GR, Kohen D, Bird AC. (1983) Visual prognosis of disciform
degeneration in myopia. Ophthalmology 90(8): 923–926.
81. Rabb MF, Garoon I, LaFranco FP. (1981) Myopic macular degeneration. Int
Ophthalmol Clin 21(3): 51–69.
82. Hayashi K, Ohno-Matsui K, Yoshida T, et al. (2005) Characteristics of
patients with a favorable natural course of myopic choroidal neovascular-
ization. Graefes Arch Clin Exp Ophthalmol 243(1): 13–19.
83. Ohno-Matsui K, Yoshida T. (2004) Myopic choroidal neovascularization:
natural course and treatment. Curr Opin Ophthalmol 15(3): 197–202.
84. Yoshida T, Ohno-Matsui K, Yasuzumi K, et al. (2003) Myopic choroidal
neovascularization: a 10-year follow-up. Ophthalmology 110(7): 1297–1305.
85. Secretan M, Kuhn D, Soubrane G, Coscas G. (1997) Long-term visual
outcome of choroidal neovascularization in pathologic myopia: natural
history and laser treatment. Eur J Ophthalmol 7(4): 307–316.
86. Fujiwara T, Imamura Y, Margolis R, et al. (2009) Enhanced depth imaging
optical coherence tomography of the choroid in highly myopic eyes. Am
J Ophthalmol 148(3): 445–450.
87. Gozum N, Cakir M, Gucukoglu A, Sezen F. (1997) Relationship between
retinal lesions and axial length, age and sex in high myopia. Eur J Ophthalmol
7(3): 277–282.
88. Curtin BJ. Pathologic myopia. (1988) Acta Ophthalmol Suppl 185: 105–106.
89. Pruett RC. (1998) Complications associated with posterior staphyloma.
Curr Opin Ophthalmol 9(3): 16–22.
90. Malagola R, Pecorella I, Teodori C, et al. (2006) Peripheral lacquer cracks
as an early finding in pathological myopia. Arch Ophthalmol 124(12):
1783–1784.
118 Jeganathan et al.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 118
119 Ocular Morbidity of Pathological Myopia
91. Ohno-Matsui K, Tokoro T. (1996) The progression of lacquer cracks in
pathologic myopia. Retina 16(1): 29–37.
92. Pierro L, Camesasca FI, Mischi M, Brancato R. (1992) Peripheral retinal
changes and axial myopia. Retina 12(1): 12–17.
93. Phillips CI, Dobbie JG. (1963) Posterior staphyloma and retinal detachment.
Am J Ophthalmol 55: 332–335.
94. Siam A. (1969) Macular hole with central retinal detachment in high myopia
with posterior staphyloma. Br J Ophthalmol 53(1): 62–63.
95. Akiba J, Konno S, Yoshida A. (1999) Retinal detachment associated with a
macular hole in severely myopic eyes. Am J Ophthalmol 128(5): 654–655.
96. Azzolini C, Patelli F, Brancato R. (2001) Correlation between optical coher-
ence tomography data and biomicroscopic interpretation of idiopathic
macular hole. Am J Ophthalmol 132(3): 348–355.
97. Benhamou N, Massin P, Haouchine B, et al. (2002) Macular retinoschisis in
highly myopic eyes. Am J Ophthalmol 133(6): 794–800.
98. Banker AS, Freeman WR. (2001) Retinal detachment. Ophthalmol Clin
North Am 14(4): 695–704.
99. Arevalo JF, Ramirez E, Suarez E, et al. (2000) Incidence of vitreoretinal
pathologic conditions within 24 months after laser in situ keratomileusis.
Ophthalmology 107(2): 258–262.
100. Arevalo JF, Ramirez E, Suarez E, et al. (2000) Rhegmatogenous retinal
detachment after laser-assisted in situ keratomileusis (LASIK) for the cor-
rection of myopia. Retina 20(4): 338–341.
101. Akiba J. (1993) Prevalence of posterior vitreous detachment in high myopia.
Ophthalmology 100(9): 1384–1388.
102. Shimada N, Ohno-Matsui K, Nishimuta A, et al. (2008) Detection of
paravascular lamellar holes and other paravascular abnormalities by optical
coherence tomography in eyes with high myopia. Ophthalmology 115(4):
708–717.
103. Forte R, Pascotto F, Napolitano F, et al. (2007) En face optical coherence
tomography of macular holes in high myopia. Eye 21(3): 436–437.
104. Coppe AM, Ripandelli G, Parisi V, et al. (2005) Prevalence of asymptomatic
macular holes in highly myopic eyes. Ophthalmology 112(12): 2103–2109.
105. Byer NE. (1998) What happens to untreated asymptomatic retinal breaks,
and are they affected by posterior vitreous detachment? Ophthalmology
105(6): 1045–1049; discussion 9–50.
106. Sharma MC, Regillo CD, Shuler MF, et al. (2004) Determination of the inci-
dence and clinical characteristics of subsequent retinal tears following treat-
ment of the acute posterior vitreous detachment-related initial retinal tears.
Am J Ophthalmol 138(2): 280–284.
107. Suzuki CR, Farah ME. (2004) Retinal peripheral changes after laser in situ
keratomileusis in patients with high myopia. Can J Ophthalmol 39(1): 69–73.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 119
108. Neuhann IM, Neuhann TF, Heimann H, et al. (2008) Retinal detachment
after phacoemulsification in high myopia: analysis of 2356 cases. J Cataract
Refract Surg 34(10): 1644–1657.
109. Chen YP, Chen TL, Yang KR, et al. (2006) Treatment of retinal detachment
resulting from posterior staphyloma-associated macular hole in highly
myopic eyes. Retina 26(1): 25–31.
110. Kobayashi K, Ohno-Matsui K, Kojima A, et al. (2005) Fundus characteristics
of high myopia in children. Jpn J Ophthalmol 49(4): 306–311.
111. Radocea R. (2006) [Fundus oculi changes in myopia]. Oftalmologia 50(1):
31–45.
112. Brazitikos PD, Safran AB, Simona F, Zulauf M. (1990) Threshold perimetry
in tilted disc syndrome. Arch Ophthalmol 108(12): 1698–1700.
113. Doshi A, Kreidl KO, Lombardi L, et al. (2007) Non-progressive glaucoma-
tous cupping and visual field abnormalities in young Chinese males.
Ophthalmology 114(3): 472–479.
114. Vuori ML, Mantyjarvi M. (2008) Tilted disc syndrome may mimic false
visual field deterioration. Acta Ophthalmol 86(6): 622–625.
115. Xu L, Li Y, Wang S, et al. (2007) Characteristics of highly myopic eyes: the
Beijing Eye Study. Ophthalmology 114(1): 121–126.
116. Huynh SC, Wang XY, Rochtchina E, Mitchell P. (2006) Peripapillary retinal
nerve fiber layer thickness in a population of six-year-old children: findings
by optical coherence tomography. Ophthalmology 113(9): 1583–1592.
117. Shimada N, Ohno-Matsui K, Yoshida T, et al. (2006) Characteristics of peri-
papillary detachment in pathologic myopia. Arch Ophthalmol 124(1): 46–52.
120 Jeganathan et al.
b846_Chapter-2.2.qxd 4/8/2010 1:56 AM Page 120
Myopia and Glaucoma
Shamira A. Perera* and Tin Aung*
,†
Introduction
Myopia is associated with glaucoma. The evidence in this area stems from
large-scale epidemiological studies and clinical studies. The finding that
a person is myopic has certain implications for their subsequent inves-
tigation and assessment from a glaucoma perspective, and influences
the interpretation of tests, clinical assessment, and management. This
chapter will summarize the association between myopia and glaucoma,
the possible reasons for the associations that have been determined, and
the clinicopathological correlation of the sequelae of myopia on glaucoma
assessment.
The Association Between Myopia and POAG
Information from epidemiological studies
The association between refractive error and glaucoma has been the sub-
ject of many clinical trials and population-based studies.
1–4
Most have sug-
gested that moderate to high myopia is associated with the increased risk
of primary open angle glaucoma (POAG),
5,6
low-tension glaucoma,
7,8
and
ocular hypertension.
9–12
For a Caucasian population in the Blue Mountains Eye Study (BMES)
in Australia, eyes with moderate myopia were two times more likely to
have POAG, after adjusting for age, sex, and other risk factors.
13
121
2.3
*Singapore Eye Research Institute & Singapore National Eye Center, Singapore. E-mail:
[email protected]

Department of Ophthalmology, Yong Loo Lin School of Medicine, National University of Singapore.
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 121
Importantly, a dose-response pattern between the increasing severity of
myopia and prevalence of glaucoma was observed. However, this was
not appreciated in the other two large epidemiological studies (Barbados
and Beaver Dam Eye Studies).
14,15
In the Barbados Eye Study, a myopic
refraction was one of several risk factors for POAG in adult black
people.
16
The Beaver Dam Eye study showed that after taking into
account the effects of age, sex, and other risk factors, persons with myopia
were 60% more likely to have glaucoma than those with emmetropia.
15
(Table 1)
The Malmö eye survey
4
found that the prevalence of glaucoma was
dose-related to the level of myopia. This association was particularly
strong at lower intraocular pressure levels.
17
However, not all studies have found significant relationships; notably
no association between myopia and POAG was found in the Ocular
Hypertension Treatment Study (OHTS) in an ethnically mixed population
of Americans.
3
An interesting study looking at inter eye differences in
refractive error and the inter eye degree of glaucomatous optic nerve dam-
age showed that the refractive error did not play a major part, at least for
eyes not exceeding –8 D.
17
Asian populations: Myopia and POAG
In Asian populations, myopia is generally more common
18
and the inci-
dence is increasing. The Beijing Eye Study from China found a significant
relationship between POAG and high myopia <−6 D
19
compared to the
remaining eyes. In contrast, in hyperopic eyes, emmetropic eyes and eyes
with low to moderate myopia (myopic refraction up to −6 diopters or
less), the frequency of glaucoma did not vary significantly.
The Meiktila Eye Study, conducted in Myanmar, also found an associ-
ation with myopia, albeit weaker than the other studies.
20
Similarly, the
population-based study in Singapore Malays (SiMES) showed an associ-
ation between moderate or higher myopia (worse than –4 D) and POAG.
Persons with moderate or higher myopia had an almost three times
higher risk of POAG compared to emmetropes. In Singapore Malays,
there was an association between increasing axial length (AL) (measured
using the IOLMaster, Carl Zeiss Jena, Germany) and POAG. This associ-
ation of moderate or higher myopia and POAG was no longer significant
after controlling for AL, suggesting that axial myopia rather than other
122 S.A. Perera and T. Aung
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 122
1
2
3
M
y
o
p
i
a

a
n
d

G
l
a
u
c
o
m
a
Table 1. Prevalence and Odds Ratio of POAG, by Refractive Status, SiMES, BDES and BMES, Right Eye only
SiMES BDES BMES
Baseline Refractive No. of % with Age-Sex OR No. of % with Age-Sex OR No. of % with Age-Sex OR
Status Eyes POAG (95% CI) Eyes POAG (95% CI) Eyes POAG (95% CI)
Myopia 583 3.3 1.7 (0.9, 3.2) 1073 3.0 1.6 (0.9, 2.6) 475 4.4 2.0 (1.1, 3.7)
Emmetropia 1511 1.7 1.0 1583 2.2 1.0 1533 1.8 1.0
Hyperopia 788 1.9 0.9 (0.5, 1.7) 734 4.0 1.1 (0.7, 1.7) 1646 1.5 0.6 (0.3, 1.0)
Refraction
Less than −3.00 217 3.7 2.1 (0.9, 4.8) 339 3.0 1.7 (0.8, 3.5) 165 4.2 2.4 (1.0, 5.7)
−1.00 to −3.00 366 3.0 1.5 (0.7, 3.2) 734 3.0 1.5 (0.9, 2.6) 310 4.5 1.9 (1.0, 3.7)
−0.75 to +0.75 1511 1.7 1.0 1583 2.2 1.0 1533 1.8 1.0
+1.00 to +2.25 651 1.8 0.9 (0.4, 1.8) 1256 3.7 1.1 (0.7, 1.7) 1029 1.2 0.5 (0.2, 1.0)
More than +2.25 137 2.2 0.9 (0.3, 3.2) 600 4.7 1.1 (0.7, 1.8) 617 1.9 0.6 (0.3, 1.3)
Myopia: −1.00 diopters or less; Emmetropia: between −0.75 and +0.75 diopters; Hyperopia: +1.00 diopters or greater.
Abbreviations: SiMES — Singapore Malay Eye Study; BDES — Beaver Dam Eye Study; BMES — Blue Mountains Eye Study.
b
8
4
6
_
C
h
a
p
t
e
r
-
2
.
3
.
q
x
d


4
/
1
4
/
2
0
1
0


1
:
5
7

P
M


P
a
g
e

1
2
3
factors (e.g. corneal curvature or lenticular changes) may be the main
biometric constituent that underlies the risk for POAG.
21
Myopia in other situations
Myopia and ocular hypertension
It is not surprising that some weaker associations have been found
between myopia and ocular hypertension, as raised intraocular pressure
(IOP) is an accepted major risk factor for the development of POAG.
The BMES study, whilst showing a strong relationship between myopia
and glaucoma, only showed a borderline relationship with ocular hyper-
tension with an odds ratio of 1.8 CI (1.2–2.9).
In one cohort study of ocular hypertensives, followed up for a mean of
7.3 years, axial myopia was found to be a significant risk factor for the
development of glaucoma.
22
This was in direct contrast to the much larger
OHTS which showed that myopia was not a predictive factor for the
development of glaucoma.
3
There is also documented interplay between some glaucoma risk factors
and myopia. The risk of steroid induced ocular hypertension is higher in
patients with severe myopia, alongside other risk factors such as a history
of open angle glaucoma and diabetes mellitus.
23
Myopia in angle closure
Generally, it is hyperopic eyes, with short axial lengths and shallow ante-
rior chamber depths that are associated with angle closure. However, angle
closure can occur in myopic eyes. In a retrospective chart review of 322
cases of primary angle closure, six cases occurred in myopic eyes.
24
This
shows that eyes with a myopic refraction are not immune from changes
that predominate in the angle recess and anterior chamber, which may
predispose to angle closure.
Myopia in Pigment Dispersion Syndrome (PDS)
It is well documented that PDS patients are frequently myopes, and that
this could play a role in the pathogenesis of reverse pupil block. It is
claimed that higher degrees of myopia lead to glaucomatous optic
124 S.A. Perera and T. Aung
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 124
neuropathy earlier,
25
and more often in PDS. This was established in a
study of 18 patients with PDS and 93 with pigmentary glaucoma, who
were analyzed for risk factors.
26
Limitations of cross-sectional studies:
Methodologic issues
There are many difficulties in performing a good population-based study,
including achieving a high participation rate and ensuring little missing
data. It is important to standardize diagnostic criteria where possible, e.g.
by using the International Society for Geographical and Epidemiological
Ophthalmology (ISGEO) criteria for the diagnosis of glaucoma based on
optic nerve changes and perimetric findings. Unfortunately, where IOP
was used to define glaucoma, such as in the Beaver Dam Eye Study, its
results are not so comparable. A standardized assessment of refraction,
IOP measurement, and glaucoma definitions strengthen the validity of
any conclusions. The measurement of AL by optical methods instead of
ultrasound methods and the use of subjective refractions by trained
optometrists instead of autorefraction are the gold standard methods of
each measurement, however, they have rarely been implemented in large
studies. A population-based design also minimizes selection bias. Some
clinic-based studies are biased by the fact that more myopes attend,
thereby increasing the likelihood of detecting POAG in these studies.
Although many studies have shown the correlation of central corneal
thickness (CCT) with optic disc parameters,
27,28
and thinner CCT has been
identified as a risk factor for the development of POAG in eyes with ocu-
lar hypertension,
3
some studies have not controlled for the influence of
CCT on myopia and glaucoma development.
The potential influence of myopia on POAG has not been derived from
longitudinal data. Only a cohort study will elucidate if myopia is associ-
ated with a risk of developing POAG, but it may take many years of
follow-up, especially considering the onset of POAG is variable and
delayed compared to the onset and stabilization of myopia. Much of this
population data has been based on single measurements (of refraction,
IOP, optic disc, and visual fields) during the course of the study. In addi-
tion, many cross-sectional studies were underpowered to elicit any asso-
ciations with myopia, especially once subdivided into relatively arbitrary
myopic categories.
125 Myopia and Glaucoma
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 125
Theories for a Link Between Myopia and POAG
The association between myopia and glaucoma:
How is it mediated?
It is unclear if the relationship between myopia (as measured by spherical
equivalent) and POAG is mediated by AL or other factors (corneal curva-
ture or lenticular changes with age) although there is some supporting
evidence from both the Meiktila eye study and the SiMES data that AL is
the mediator. Comparatively, the SiMES data is more robust as many stud-
ies have not controlled for the effects of central corneal thickness, which is
now known to strongly influence the measurement of IOP and is a risk
factor for POAG.
3
Several theories have been put forward to explain a true link between
myopia and POAG. Myopia has been found to influence IOP, with myopes
associated with having higher IOP than emmetropes and hyperopes. The
Blue Mountains study found 0.45-mmHg IOP difference between myopic
and emmetropic eyes.
13
This was slightly lower than in some previous
reports, which have reported differences ranging from 0.75 to more than
1.0 mmHg.
8,29,30
This has failed to be replicated in the Beijing Eye Study, where the mean
IOP was not significantly different between the eyes with marked and high
myopia compared to the remaining eyes, despite having a significantly
higher frequency of glaucoma.
31
Other studies have reported higher appla-
nation pressures in children,
32
or in subjects with increased axial length.
33
This may shed some light on the variation in findings of the population-
based studies.
Glaucoma Assessment in Myopic Eyes
Biometric differences
Axial length and CCT
Recently, there has been some interest in CCT, as it was revealed as a sig-
nificant risk factor for the development of glaucoma in ocular hyperten-
sives,
3
and as its role in accurate IOP measurement became known. Longer
AL, however, does not correlate with CCT in myopes
34
or in populations
of normal or glaucoma patients.
35
The relationship between CCT and
refractive error favors no correlation. Although in myopic populations,
126 S.A. Perera and T. Aung
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 126
Chang et al. reported that the CCT was thinner in the more myopic eyes,
Fam et al.
36
found no correlation with the degree of myopia with CCT in
Singaporean Chinese. Among normal populations, a significant correla-
tion between CCT and refraction was demonstrated in the Japanese.
37
However, for the majority of studies in Chinese and Malays, CCT was not
correlated with refraction.
38–40
Optic disc assessment in myopic eyes
The clinical diagnosis of glaucoma in myopic eyes may be difficult. The
optic discs of myopes are notoriously difficult to assess, especially those
with coexistent tilted discs.
41
The discs frequently appear glaucomatous
with larger diameters, greater cup disc ratios, and larger and shallower
optic cups.
42–44
Myopic discs are often obliquely inserted and tilted.
45
A
possible source of bias for graders in studies is that highly myopic eyes
usually show a characteristic appearance of the optic nerve head with an
enlarged disc, shallow cupping, a large myopic crescent, and fundus
hypopigmentation (Figs. 1 and 2).
127 Myopia and Glaucoma
Figure 1
Figure 2
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 127
Visual fields in myopic eyes
In addition, myopic retinal degeneration, which is common in high
myopes, may cause visual field defects that mimic glaucomatous visual
field defects. Non-glaucomatous visual field abnormalities, e.g. enlarged
blind spots and superotemporal defects, have been reported in both
highly myopic eyes and those with tilted discs.
46–48
It is important not to
overstate the effect of simple myopia on visual field testing. In one study,
there appeared to be a low prevalence of visual field defects amongst a
population of young healthy myopic males with no myopic degeneration.
The observation that myopia affected threshold sensitivity, especially in
higher degrees of myopia
48
and in relation to AL,
49
may be explained by
microscopic structural changes in the retina and choroid, axial elongation
of the eye with increased spacing of retinal photoreceptors, or distortion
of the stimulus by the negative prescription of the lenses. It is possible
that such cases of high myopia may have been misclassified as POAG in
studies, leading to a spurious association between myopia and POAG.
In younger myopic individuals with tilted optic discs, significant focal
visual field defects were rare, suggesting that these defects probably do
not develop until their later years.
50
Abnormal visual fields in myopic eyes
have also been reported when tested with other forms of perimetry.
Myopic optical defocus has a significant effect on the Humphrey Matrix
30–2 test results, impacting more so in the moderate-myopic group than
in low-myopic eyes.
51
Imaging tests and variations with myopia
Recently, there has been an explosion in new technologies, which aim to
give quantitative and objective measurements of optic nerve head (ONH)
and retinal nerve fibre layer (RNFL) parameters. Although they have rea-
sonable sensitivity and specificity for detecting glaucoma, each technology
has some challenges when assessing myopic eyes. A study using the
Stratus-optical coherence tomography (OCT) revealed that overall RNFL
thickness decreased 7 microns per 1 mm of axial length, and 3 microns per
1 D sphere. Moderately myopic subjects tended to have thinner peripapil-
lary RNFL, mainly at the superior and inferior poles, which would make
judging the RNFL thickness at these critical points less straightforward.
This, together with the likelihood of having a thinner RNFL, should be
considered when interpreting a glaucoma suspect’s OCT measurements
128 S.A. Perera and T. Aung
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 128
compared with the normative database.
52
For eyes with a spherical equiv-
alent of <−10.0 D, it has been shown that the average RNFL thickness is
80 µm, as opposed to 100 µm in emmetropes.
53
Myopic eyes were more
likely to develop abnormal birefringence patterns in both types of scan-
ning laser polarimetry (GDx
TM
VCC and ECC, Carl Zeiss Meditec, Jena,
Germany).
54
This could stem from a more spread out RNFL and may lead
to anomalous diagnoses if not used together with clinical assessment. In
contrast, Heidelberg retinal tomography (Heidelberg Engineering,
Heidelberg, Germany) tests do not seem to be as affected by refractive
error as they are by optic disc tilt.
55
ONH susceptibility to damage
Jonas and Budde
56
showed that for a given intraocular pressure (IOP)
level in eyes with POAG, optic nerve damage appears to be more pro-
nounced in highly myopic eyes with large optic discs than in non-highly
myopic eyes. The optic nerve head in myopic eyes may be more suscepti-
ble to glaucomatous damage from elevated or normal IOP
57,58
than in non-
myopic eyes. Also, the cup-disc-ratio is higher in myopes,
60
which may
predispose more nerve fibers to damage at any level of IOP
60–62
as shearing
forces exerted by scleral tension across the lamina cribrosa are heightened
in myopia for the same IOP.
63
It has been proposed that similar connective
tissue changes may also occur in glaucoma and myopia.
64,65
The finding
that AL largely explains the association between myopia and POAG also
supports a theory involving the connective tissue changes associated with
longer axial dimensions as a potential mechanism for POAG. It may fit
with the finding of a thinner lamina cribrosa in combination with a
secondary enlargement of the optic nerve head in highly myopic eyes.
66–70
In two cadaveric studies, it was found that in highly myopic eyes, the lam-
ina cribrosa was significantly thinner than in non-highly myopic eyes.
71,72
This was postulated to steepen the translaminar pressure gradient for a
given intraocular pressure and cause increased susceptibility to glaucoma
in highly myopic eyes.
A trial combing A-scan ultrasonography with confocal scanning laser
ophthalmoscope images of the optic disc showed that increased disc area
is associated with longer axial length measurements (and African ancestry)
in normal individuals. This may have implications for pathophysiology
and risk assessment of glaucoma, as these normal eyes may be misclassi-
fied as glaucomatous.
73
129 Myopia and Glaucoma
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 129
It is logical that myopia exhibits its influence via eye size and lamina
cribrosa biomechanical properties. The resulting changes in ONH biome-
chanics may play a role in retinal ganglion cell loss inglaucomatous optic
neuropathy.
74
Ocular blood flow, which has a role in the pathophysiology of glaucoma,
also seems to be affected by the structural changes in myopia. Flow in
the ophthalmic
75
and retinal arteries
76
in very high myopes with glaucoma
has been found to be significantly reduced when compared with controls.
This reduction may lead to an increased vulnerability to the effects of IOP.
The Influence of Myopia on the Clinical Management
of the Glaucoma Patient
There are no current differences in the treatment of myopes with glaucoma
compared to any other refractive error. Previously, when pilocarpine was
commonplace, it was avoided in high myopes because of the risk of retinal
detachment. Glaucomatous eyes with high myopia poses some additional
problems, as the increased axial length, the thinner sclera, and larger intraoc-
ular volume predispose the eyes to choroidal effusions as the IOP rapidly
drops post filtration surgery. The thinner sclera of myopes may collapse,
leading to hypotony and shallow anterior chamber after both trabeculectomy
and post-glaucoma drainage device surgeries.
77
Deep sclerectomy has been
reported to cause fewer of these complications with a more gradual allevia-
tion of the high IOP, however, this must be balanced against other factors,
such as the steep learning curve and the more modest IOP lowering.
78
Glaucoma progression and myopia
POAG patients with myopia more severe than −6 D had a greater progres-
sion of visual field loss as revealed by logistic regression in one study. The
incidence of VF loss progression was 15.1% in the group of eyes with
myopia less severe than −3 D, 10.5% in the group with −3 D to −6 D, 34.4%
in the group with −6 D to −9 D, and 38.9% in the group with myopia more
severe than −9 D.
79
This is supported by another study in Japan, which
found only myopia worse than −4.0 as a major risk for progression in
POAG.
80
To place these findings in perspective though, it is more likely that
other factors, such as elevated initial IOP, wide variations and poor control
of IOP, late detection of glaucoma, and non-compliance with therapy, play
a more important role in the development of blindness.
81
130 S.A. Perera and T. Aung
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 130
References
1. The Advanced Glaucoma Intervention Study (AGIS): 12. (2002) Baseline risk
factors for sustained loss of visual field and visual acuity in patients with
advanced glaucoma. Am J Ophthalmol 134(4): 499–512.
2. Fong DS, Epstein DL, Allingham RR. (1990) Glaucoma and myopia: Are they
related? Int Ophthalmol Clin 30(3): 215–218.
3. Gordon MO, et al. (2002) The Ocular Hypertension Treatment Study:
Baseline factors that predict the onset of primary open-angle glaucoma. Arch
Ophthalmol 120(6): 714–720; discussion 829–830.
4. Grodum K, Heijl A, Bengtsson B. (2001) Refractive error and glaucoma. Acta
Ophthalmol Scand 79(6): 560–566.
5. Knapp A. (1925) Glaucoma in myopic eyes. Trans Am Ophthalmol Soc 23:
61–70.
6. Podos SM, Becker B, Morton WR. (1966) High myopia and primary open-
angle glaucoma. Am J Ophthalmol 62(6): 1038–1043.
7. Abdalla MI, Hamdi M. (1970) Applanation ocular tension in myopia and
emmetropia. Br J Ophthalmol 54(2): 122–125.
8. Perkins ES, Phelps CD. (1982) Open angle glaucoma, ocular hypertension,
low-tension glaucoma, and refraction. Arch Ophthalmol 100(9): 1464–1467.
9. Daubs JG, Crick RP. (1981) Effect of refractive error on the risk of ocular
hypertension and open angle glaucoma. Trans Ophthalmol Soc UK 101(1):
121–126.
10. David R, et al. (1985) The correlation between intraocular pressure and
refractive status. Arch Ophthalmol 103(12): 1812–1815.
11. Seddon JM, Schwartz B, Flowerdew G. (1983) Case-control study of ocular
hypertension. Arch Ophthalmol 101(6): 891–894.
12. Tomlinson A, Phillips CI. Applanation tension and axial length of the eyeball.
Br J Ophthalmol 18–5970. 54(8): 543.
13. Mitchell P, et al. (1999) The relationship between glaucoma and myopia: the
Blue Mountains Eye Study. Ophthalmology 106(10): 2010–2015.
14. Wu SY, Nemesure B, Leske MC. (2000) Glaucoma and myopia.
Ophthalmology 107(6): 1026–1027.
15. Wong TY, et al. (2003) Refractive errors, intraocular pressure, and glaucoma
in a white population. Ophthalmology 110(1): 211–217.
16. Wu SY, Nemesure B, Leske MC. (1999) Refractive errors in a black adult
population: The Barbados Eye Study. Invest Ophthalmol Vis Sci 40(10):
2179–2184.
17. Jonas JB, Martus P, Budde WM. (2002) Anisometropia and degree of optic
nerve damage in chronic open-angle glaucoma. Am J Ophthalmol 134: 547–551.
18. Lin LLK, Shih YF, Tsai CB, et al. (1999) Epidemiologic study of ocular
refraction among schoolchildren in Taiwan in 1995. Optom Vis Sci 76:
275–281.
131 Myopia and Glaucoma
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 131
19. Xu L, Wang Y, Wang S, et al. (2007) High myopia and glaucoma susceptibility
the Beijing Eye Study. Ophthalmology 114(2): 216–220.
20. Casson RJ, Gupta A, Newland HS, et al. (2007) Risk factors for primary open-
angle glaucoma in a Burmese population: The Meiktila Eye Study. Clin
Experiment Ophthalmol 35(8): 739–744.
21. Perera SA, Wong TY, Tay WT, et al. (2009) Refractive Error, Axial Dimensions
and Primary Open Angle Glaucoma: The Singapore Malay Eye Study.
Accepted by Archives of Ophthalmology.
22. Georgopoulos G, Andreanos D, Liokis N, et al. (1997) Risk factors in ocular
hypertension. Euro J Ophthalmol 7(4): 357–363.
23. Vetrugno M, Maino A, Quaranta M, Cardia L. (2000) A randomized, com-
parative open-label study on the efficacy of latanaprost and timolol in steroid
induced ocular hypertension after photorefractive keratectomy. Eur J
Ophthalmol 10: 205–211.
24. Chakravarti T, Spaeth GL. (2007) The prevalence of myopia in eyes with angle
closure. J Glaucoma 16(7): 642–643.
25. Berger A, Ritch R, McDermott JA, Wang RF. (1987) Pigmentary dispersion,
refraction and glaucoma. Invest Ophthalmol Vis Sci 28(Suppl): 114–119.
26. Farrar SM, Shields MB, Miller KN, Stoup CM. (1989) Risk factors for the
development and severity of glaucoma in the pigment dispersion syndrome.
Am J Ophthalmol 108(3): 223–229.
27. Jonas JB, Stroux A, Velten I, et al. (2005) Central corneal thickness correlated
with glaucoma damage and rate of progression. Invest Ophthalmol Vis Sci 46:
1269–1274.
28. Henderson PA, Medeiros FA, Zangwill LM, Weinreb RN. (2005) Relationship
between central corneal thickness and retinal nerve fiber layer thickness in
ocular hypertensive patients. Ophthalmology 112(2): 251–256.
29. Abdalla MI, Hamdi M. (1970) Applanation ocular tension in myopia and
emmetropia. Br J Ophthalmol 54: 122–125.
30. Shiose Y, Kitazawa Y, Tsukahara S, et al. (1991) Epidemiology of glaucoma in
Japan: A nationwide glaucoma survey. Jpn J Ophthalmol 35: 133–155.
31. Xu L, et al. (2007) High myopia and glaucoma susceptibility the Beijing Eye
Study. Ophthalmology 114(2): 216–220.
32. Quinn GE, Berlin JA, Young TL, et al. (1995) Association of intraocular
pressure and myopia in children. Ophthalmology 102: 180–185.
33. Tomlinson A, Phillips CI. (1970) Applanation tension and axial length of the
eyeball. Br J Ophthalmol 54: 548–553.
34. Al-Mezaine HS, et al. (2008) The relationship between central corneal
thickness and degree of myopia among Saudi adults. Int Ophthalmol
Epub 28. June 2008.
35. Ventura AC, Bohnke M, Mojon DS. (2001) Central corneal thickness
measurements in patients with normal tension glaucoma, primary open angle
132 S.A. Perera and T. Aung
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 132
glaucoma, pseudoexfoliation glaucoma, or ocular hypertension. Br J
Ophthalmol 85(7): 792–795.
36. Fam HB, How AC, Baskaran M, et al. (2006) Central corneal thickness and its
relationship to myopia in Chinese adults. Br J Ophthalmol 90: 1451–1453.
37. Suzuki S, Suzuki Y, Iwase A, Araie M. (2005) Corneal thickness in an ophthal-
mologically normal Japanese population. Ophthalmology 112: 1327–1336.
38. Cho P, Lam C. (1999) Factors affecting the central corneal thickness of Hong
Kong Chinese. Curr Eye Res 18: 368–374.
39. Chang SW, Tsai IL, Hu FR, Lin LL, Shih YF. (2001) The cornea in young
myopic adults. Br J Ophthalmol 85: 961–970.
40. Tong L, Saw SM, Siak JK, et al. (2004) Corneal thickness determination and cor-
relates in Singaporean schoolchildren. Invest Ophthalmol Vis Sci 45: 4004–4009.
41. Nicolela MT, Drance SM. (1996) Various glaucomatous optic nerve appear-
ances. Clinical correlations. Ophthalmology 103: 640–649.
42. Jonas JB, Dichtl A. (1997) Optic disc morphology in myopic primary open-
angle glaucoma. Graefes Arch Clin Exp Ophthalmol 235(10): 627–633.
43. Dichtl A, Jonas JB, Naumann GO. (1998) Histomorphometry of the optic disc
in highly myopic eyes with absolute secondary angle closure glaucoma. Br J
Ophthalmol 82(3): 286–289.
44. Jonas JB, Gusek GC, Naumann GO. (1988) Optic disk morphometry in high
myopia. Graefes Arch Clin Exp Ophthalmol 226(6): 587–590.
45. How AC, Tan GS, Chan YH, et al. (2009) Population prevalence of tilted and
torted optic discs among an adult Chinese population in Singapore: The
Tanjong Pagar Study. Arch Ophthalmol 127(7): 894–899.
46. Brazitikos PD, Safran AB, Simona F, Zulauf M. (1990) Threshold perimetry in
tilted disc syndrome. Arch Ophthalmol 108: 1698–1700.
47. Ito A, Kawabata H, Fujimoto N, Adachi-Usami E. Effect of myopia on
frequency-doubling perimetry. Invest Ophthalmol Vis Sci 42: 1107–1110.
48. Aung T, Foster PJ, Seah SK, et al. (2001) Automated static perimetry: The influ-
ence of myopia and its method of correction. Ophthalmology 108: 290–295.
49. Rudnicka AR, Edgar DF. (1995) Automated static perimetry in myopes with
peripapillary crescents — part I. Ophthalmic Physiol Opt 15: 409–412.
50. Tay E, Seah SK, Chan SP, et al. (2005) Optic disk ovality as an index of tilt and
its relationship to myopia and perimetry. Am J Ophthalmol 139(2): 247–252.
51. Kim JH, Kee C. (2009) The effect of myopic optical defocus on the Humphrey
Matrix 30–2. Threshold test. J Glaucoma Aug 5. [Epub ahead of print].
52. Rauscher FM, Sekhon N, Feuer WJ, Budenz DL. (2009) Myopia affects retinal
nerve fiber layer measurements as determined by optical coherence tomogra-
phy. J Glaucoma 18(7): 501–505.
53. Schweitzer KD, Ehmann D, García R. (2009) Nerve fiber layer changes in
highly myopic eyes by optical coherence tomography. Can J Ophthalmol
44(3): e13–6.
133 Myopia and Glaucoma
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 133
54. Qiu K, Leung CK, Weinreb RN, et al. (2009) Predictors of atypical birefrin-
gence pattern in scanning laser polarimetry. Br J Ophthalmol 93(9):
1191–1194. Epub 2009 May 4.
55. Tong L, Chan YH, Gazzard G, et al. (2007) Heidelberg retinal tomography of
optic disc and nerve fiber layer in Singapore children: Variations with disc tilt
and refractive error. Invest Ophthalmol Vis Sci 48(11): 4939–4944.
56. Jonas JB, Budde WM. (2005) Optic nerve damage in highly myopic eyes with
chronic open-angle glaucoma. Eur J Ophthalmol 15: 41–47.
57. Chihara E, et al. (1997) Severe myopia as a risk factor for progressive visual
field loss in primary open-angle glaucoma. Ophthalmologica 211(2): 66–71.
58. Lotufo D, et al. (1989) Juvenile glaucoma, race, and refraction. JAMA 261(2):
249–252.
59. Tomlinson A, Phillips CI. (1969) Ratio of optic cup to optic disc. In relation
to axial length of eyeball and refraction. Br J Ophthalmol 53: 765–768.
60. Chihara E, Sawada A. (1990) Atypical nerve fiber layer defects in high myopes
with high-tension glaucoma. Arch Ophthalmol 108: 228–232.
61. Jonas JB, Dichtl A. (1997) Optic disc morphology in myopic primary open-
angle glaucoma. Graefes Arch Clin Exp Ophthalmol 235: 627–633.
62. Jonas JB, Gusek GC, Naumann GO. (1988) Optic disk morphometry in high
myopia. Graefes Arch Clin Exp Ophthalmol 226: 587–590.
63. Cahane M, Bartov E. (1992) Axial length and scleral thickness effect on
susceptibility to glaucomatous damage: A theoretical model implementing
Laplace’s law. Ophthalmic Res 24: 280–284.
64. Curtin BJ, Iwamoto T, Renaldo DP. (1979) Normal and staphylomatous
sclera of high myopia. An electron microscopic study. Arch Ophthalmol 97:
912–915.
65. Quigley HA. (1987) Reappraisal of the mechanisms of glaucomatous optic
nerve damage. Eye 1: 318–322.
66. Jonas JB, Gusek GC, Naumann GO. (1988) Optic disk morphometry in high
myopia. Graefes Arch Clin Exp Ophthalmol 226: 587–590.
67. Jonas JB, Berenshtein E, Holbach L. (2004) Lamina cribrosa thickness and
spatial relationships between intraocular space and cerebrospinal fluid space
in highly myopic eyes. Invest Ophthalmol Vis Sci 45: 2660–2665.
68. Morgan WH, Yu DY, Cooper RL, et al. (1995) The influence of cerebrospinal
fluid pressure on the lamina cribrosa tissue pressure gradient. Invest
Ophthalmol Vis Sci 36: 1163–1172.
69. Bellezza AJ, Hart RT, Burgoyne CF. (2000) The optic nerve head as a biome-
chanical structure: Initial finite element modeling. Invest Ophthalmol Vis Sci
41: 2991–3000.
70. Jonas JB, Berenshtein E, Holbach L. (2003) Anatomic relationship between
lamina cribrosa, intraocular space, and cerebrospinal fluid space. Invest
Ophthalmol Vis Sci 44: 5189–5195.
134 S.A. Perera and T. Aung
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 134
71. Jonas JB, Berenshtein E, Holbach L. (2004) Lamina cribrosa thickness and
spatial relationships between intraocular space and cerebrospinal fluid space
in highly myopic eyes. IOVS 45: 2660–2665.
72. Ren R, Wang N, Li B, et al. (2009) Lamina cribrosa and peripapillary sclera
histomorphometry in normal and advanced glaucomatous Chinese eyes with
various axial length. Invest Ophthalmol Vis Sci 50(5): 2175–2184.
73. Oliveira C, Harizman N, Girkin CA, et al. (2007) Axial length and optic disc
size in normal eyes. Br J Ophthalmol 91(1): 37–39.
74. Sigal A, Flanagan JG, Ethier CR. (2005) Factors Influencing Optic Nerve Head
Biomechanics. Invest Ophthalmol Vis Sci 46(11): 4189–4199.
75. Galassi F, Sodi A, Ucci F, et al. Ocular haemodynamics in glaucoma associated
with high myopia. Int Ophthalmol 22(5): 299–305.
76. Shimada N, Ohno-Matsui K, Harino S, et al. (2004) Reduction of retinal blood
flow in high myopia. Graefes Arch Clin Exp Ophthalmol 242(4): 284–288.
77. Park HY, Lee NY, Park CK. (2009) Risk factors of shallow anterior chamber
other than hypotony after Ahmed glaucoma valve implant. J Glaucoma. 18(1):
44–48.
78. Hamel M, Shaarawy T, Mermoud A. (2001) Deep sclerectomy with collagen
implant in patients with glaucoma and high myopia. J Cataract Refract Surg.
27: 1410–1417.
79. Lee YA, Shih YF, Lin LL, et al. (2008) Association between high myopia and
progression of visual field loss in primary open-angle glaucoma. J Formos
Med Assoc. 107(12): 952–957.
80. Chihara E, Liu X, Dong J, et al. (1997) Severe myopia as a risk factor for pro-
gressive visual field loss in primary open-angle glaucoma. Ophthalmologica.
211(2): 66–71.
81. Kooner KS, Albdoor M, Cho BJ, Adams-Huet B. (2008) Risk factors for pro-
gression to blindness in high tension primary open angle glaucoma:
Comparison of blind and non-blind subjects. Clin Ophthalmol. 2(4):
757–762.
135 Myopia and Glaucoma
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 135
b846_Chapter-2.3.qxd 4/14/2010 1:57 PM Page 136
This page intentionally left blank This page intentionally left blank
The Myopic Retina
Shu-Yen Lee*
,†
A crescent of peripapillary atrophy, chorioretinal degeneration and atrophy,
lattice degeneration and posterior staphyloma are very common findings in
the posterior segment of the elongated myopic eye. With higher levels of
myopia, particularly if the myopia is greater than –6.00 DS or the axial
length greater than 26 mm, the retina may be more severely affected. In the
presence of myopic macular degeneration and atrophy, the macula is at risk
of lacquer cracks and choroidal neovascularization, potentially causing the
loss of central vision. The lattice degeneration is prone to retinal breaks, and
thus predisposes the eye to retinal detachment. Abnormal vitreoretinal
relationships are not uncommon, and can result in macular holes and
detachment, myopic foveoschisis and vitreomacular traction.
Posterior Staphyloma
The posterior staphyloma is a pathognomonic feature of eyes with patho-
logic myopia. It is a localized ectasia of the sclera, choroids, and retinal
pigment epithelium that can be of variable size and involve different
aspects of the posterior fundus. The morphological classification of poste-
rior staphylomatous findings were described by Curtin
1
to nasal, macula-
centered, disc-centered and tiered staphylomas. These staphylomas are best
observed with indirect binocular ophthalmoscopy and B-scan ultrasonog-
raphy. The posterior staphylomas are usually present from a young age and
may progress with age, particularly with high myopias and long axial
lengths. Vision progressively deteriorates in eyes with staphylomas that are
137
2.4
*Singapore National Eye Centre, Singapore. E-mail: [email protected]

Duke-National University of Singapore, Graduate Medical School, Singapore.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 137
macula-centered because of the progressive thinning of the choroids and
retinal pigment epithelium in the macula.
2
Myopic Chorioretinal Atrophy
The terms “tessellated” and “tigroid” fundus appearances have been
commonly used to describe the myopic retina. As a consequence of the
elongation of the globe and the internal structures within, peripapillary
crescent formation and chorioretinal atrophy are common features seen in
highly myopic eyes
3,4
(Fig. 1).
The areas of atrophy may be focal or diffused, defined or irregularly
shaped, isolated or composed of multiple pale white areas in the posterior
pole. There may be clumps of pigment within these areas. The choroidal
vessels are usually easily seen beneath the thinned out retina. Fundus
fluorescein angiography would show staining of these atrophic areas while
they are hypofluorescent with indocyanine green angiography.
The natural history of these areas of atrophy is gradual enlargement
and coalescence. As the fovea becomes more extensively involved, central
vision becomes progressively affected.
138 S.-Y. Lee
Figure 1. Myopic fundus with peripapillary atrophy and a large area of chorioretinal atrophy
within the macula.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 138
Lacquer Cracks
With the thinning of the retinal pigment epithelium and choroid,
ruptures of Bruch’s membrane occurs in up to 4.2%.
5
These typically
occur with a streak of retinal hemorrhage that is not associated with any
underlying choroidal neovascularization. Upon resolution of the blood,
pale linear or stellate lines are revealed across the macula (Fig. 2), without
disruption of the adjacent retina. The lacquer cracks are best defined as
linear hyperfluorescence in the early phase of fluorescein angiography
and late hypofluorescence on indocyanine angiography. Over time, the
cracks may widen and join with areas of atrophy. Central vision may be
affected depending on the course of the lacquer crack, especially if there
is foveal involvement. It should be noted that the presence of lacquer
cracks does put the eye at risk of choroidal neovascularization. Hence,
lacquer cracks are not innocuous findings and central visual prognosis
may be guarded.
In our series of 28 Asian eyes with myopia of greater than –6.0 DS, six
eyes (21.4%) were found to have lacquer cracks as the underlying cause.
The mean initial visual acuity was 6/36 and progressively improved to 6/21
at 3 months, 6/15 at 6 months and 6/18 at 12 months. In general, the
139 The Myopic Retina
Figure 2. Myopic macula chorioretinal degeneration with lacquer crack across the fovea.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 139
prognosis for central vision is good once the hemorrhage has cleared,
unless there is foveal involvement. A lacquer crack that courses the fovea
will result in persistent metamorphopsia and deterioration of central
acuity.
Myopic Choroidal Neovascularization
Myopic choroidal neovascularization (mCNV) has been reported to
occur in up to 10% in those with myopia
6
and up to 40.7% in high
myopia.
7
The patient would report metamorphopsia or central blurring
of vision that occurs acutely. The mCNV typically occurs at the edge of
a lacquer crack or an area of atrophy within the macula. The area
of hemorrhage is usually small with minimal serous exudation com-
pared to the age-related type of choroidal neovascularization. A well-
defined grey subretinal membrane can often be seen adjacent to the
hemorrhage (Fig. 3a).
The typical term that has been used to describe a pigmented lesion in
the myopic macula is a Foerster–Fuchs’ spot.
8,9
This represents subretinal
or intraretinal migration of RPE accompanying the CNV.
140 S.-Y. Lee
Figure 3a. A myopic CNV which is seen as a greyish subfoveal membrane with surrounding
subretinal blood.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 140
Fluorescein angiography would usually show that the mCNV, in the
majority of cases, is located in the subfoveal and juxtafoveal areas (Fig. 3b).
It is usually of the classic type of network seen and does not leak as exu-
berantly as in the age-related type of CNV.
The visual prognosis is controversial. It is not unusual for the mCNV to
spontaneously involute or to remain in status quo, unlike the age-related
CNV. However, despite the involution, there is continued and progressive
chorioretinal atrophy around the scar or pigmented mound of the invo-
luted CNV, resulting in progressive loss of central vision. There is also a
high recurrence rate.
Treatment is however, often considered. Focal laser photocoagulation
works well in destroying the vascular network, but because of the potential
damage to the photoreceptors, it is now largely reserved for the treatment
of extrafoveal lesions. Focal laser for juxtafoveal lesions is controversial,
mainly because of the high rate of recurrences. The options currently
available for the treatment of subfoveal and juxtafoveal mCNVs are
photodynamic therapy with verteporfin (PDT) and anti-vascular
endothelial growth factor (VEGF) intravitreal injections. The VIP study
141 The Myopic Retina
Figure 3b. Fluorescein angiogram showing the classic CNV.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 141
142 S.-Y. Lee
(a) (b)
(c)
(d) (e)
Figure 4. A 53-year-old female with myopia of –8.50 DS, presented with a subfoveal hemorrhage
in the right eye with visual acuity 6/15 (4a). The fluorescein anigoram showed the presence
of a myopic CNV involving the macula (4b). The OCT scan showed the subretinal fluid
space and the subretinal neovascular membrane (4c). (4d) and (4e) She received a single
dose of intravitreal bevacizumab 1.25 mg/0.05 ml and the vision improved to 6/9 after one
month and this was maintained after 12 months. However there was formation of chorio-
retinal atrophy around the involuted mCNV (black arrow).
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 142
showed that PDT resulted in fewer retreatments with stabilization or
improvement in vision in 76% of eyes up to 12 months, beyond which
reading ability starts to deteriorate largely due to the progressive chori-
oretinal atrophy surrounding the involuted mCNV. Intravitreal injections
with anti-VEGF agents, such as ranibizumab and bevacizumab, result in
a rapid return of vision with resolution of the hemorrhages and involu-
tion of the mCNV. It also potentially causes less damage to the surround-
ing choroid and retinal pigment epithelium. The SNEC experience is that
whilst there is faster visual recovery compared to treatment with PDT
with better visual outcome at 12 months (Fig. 4). With PDT, there is ini-
tial visual improvement but after 6 months, the visual outcome tends
towards that of natural history, probably due to the inevitable develop-
ment of chorioretinal atrophy.
Currently, it is possible to result in involution of the mCNV. The real
challenge in the management of mCNV is to halt the progressive chori-
oretinal atrophy, which at this point in time is not possible.
Myopic Foveoschisis
As a consequence of the ectasia secondary to the posterior staphyloma,
highly myopic individuals can develop foveoschisis. This is the splitting of
the retinal layers in the macula (Fig. 5), which can cause blurring of vision
143 The Myopic Retina
Figure 5. There is splitting of the retinal layers of the macula in the presence of myopic
foveoschisis as seen on this OCT scan.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 143
and metamorphopsia. It can then progress on to a myopic macular hole
formation that may be associated with a retinal detachment.
Surgical intervention may be necessary to restore the anatomy and
visual function. The surgical procedures that have been performed include
vitrectomy with gas tamponade and macular buckling.
Myopic macular hole detachments
Macular holes can develop in highly myopic eyes. This usually occurs as a
consequence of tractional forces from the vitreoretinal interface (Fig. 6).
Often, a localized detachment arises within the macula, which over time,
can extend peripherally (Fig. 7).
Surgery would be warranted for re-establishment of anatomy, and this
would involve a vitrectomy with clearance of the posterior cortical
vitreous and peeling of the internal limiting membrane with internal
gas tamponade and face down posturing postoperation. The surgery is
challenging, as the retina is usually thin and atrophic, while the retinal
pigment epithelium is also very thin, and not uncommonly, there is only
bare sclera. Hence, other adjunctive measures have been proposed such as
the macula buckle and cryopexy or photocoagulation of the edge of the
144 S.-Y. Lee
Figure 6. Myopic macular hole.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 144
macula hole to induce permanent adhesion. Silicone oil may not be a good
option because of extreme convexity seen in these eyes with posterior
staphylomas. The visual prognosis is guarded, even if the macula detach-
ment is fixed because of the damage to the atrophic macula.
Lattice degeneration
Lattice degeneration is a peripheral vitreoretinal thinning that is clinically
important because of the potential risk of developing retinal tears and
detachments. It is present in about 10% of the population
10
and more
commonly so in high myopia.
Lattice lesions can vary in their appearance. They can be linear or oval
lesions of retinal thinning that can be of various sizes and extents of pig-
mentation. They are usually anterior to the equator and circumferential in
distribution. Some may have round atrophic holes within them. These are
not considered to be major risk factors for retinal detachment, however,
lattice degeneration has been reported in up to 20% of all detachments,
and Byer showed that the risk of developing retinal detachment in the
presence of lattice degeneration is about 0.3 to 0.5%.
10
145 The Myopic Retina
Figure 7. A myopic retina with a macular hole with surrounding retinal detachment within the
macula.
b846_Chapter-2.4.qxd 4/8/2010 1:57 AM Page 145
As the margin of lattice degeneration is associated with vitreous adhe-
sions, posterior vitreous detachments can result in a tractional retinal tear
along the edges of the lesion. Despite the risk of developing retinal tears
and retinal detachments, prophylactic laser of lattice degeneration as a
means to prevent retinal detachment is not universally accepted. This is
usually recommended if there is a symptomatic retinal tear or a history of
retinal detachment in the fellow eye.
Retinal tears and detachments
Retinal detachments (Fig. 8) occur in about one in 10,000 of the popula-
tion.
11
This increases with increasing degrees of myopia. 67 percent of
detachments occur in eyes with myopia. The myopic eyes that develop
retinal detachments tend to be younger than those whose detachments
occur as a consequence of posterior vitreous detachment. It is also
not infrequent that these individuals are found to have bilateral retinal
detachments, which may be asymptomatic.
146 S.-Y. Lee
Figure 8. Peripheral lattice degeneration with pigmentation and an atrophic round hole within.
b846_Chapter-2.4.qxd 4/8/2010 1:58 AM Page 146
Surgery is necessary to re-establish retinal anatomy and to restore visual
function. Scleral buckling and vitrectomy procedures when well selected
are excellent surgical options for this problem.
References
1. Curtin BJ. (1977) The posterior staphyloma of pathologic myopia. Trans Am
Ophthalmol Soc 75: 67–86.
2. Noble KG, Carr RE. (1982) Pathologic myopia. Ophthalmology 89: 1099–1100.
3. Curtin BJ. (1985) The Myopias: Basic Science and Clinical Management.
Harper & Row, Philadelphia.
4. Curtin BJ, Karlin DB. (1971) Axial length measurements and fundus changes
in the myopic eye. Am J Ophthalmol 71: 42–53.
5. Curtin BJ, Karlin DB. (1971) Axial length measurements and fundus changes
in the myopic eye. Am J Ophthalmol 71: 42–53.
6. Curtin BJ. (1963) The pathogenesis of congenital myopia: A study of 66 cases.
69: 166–173.
7. Hotchkiss ML, Fine SL. (1981) Pathologic myopia and choroidal neovascu-
larisation. Am J Ophthalmol 91: 177–183.
147 The Myopic Retina
Figure 9. Retinal detachment involving the macula secondary to multiple retinal breaks
superiorly.
b846_Chapter-2.4.qxd 4/8/2010 1:58 AM Page 147
8. Foerster R. (1862) Ophthalmologische Beitrage, Berlin, Enslin.
9. Fuchs E. (1901) Der centrale schwarze Fleck bei Myopie. Z Augenheilkd
5: 171–178.
10. Byer NE. (1989) Long term natural history of lattice degeneration of the
retina. Ophthalmology 96(9): 1396–1401.
11. Rosman M, Wong TY, Ong SG, Ang CL. (2001) Retinal detachment in
Chinese, Malay and Indian residents in Singapore: a comparative study of risk
factors, clinical presentations and surgical outcomes. Int Ophthalmol 84(2):
101–106.
148 S.-Y. Lee
b846_Chapter-2.4.qxd 4/8/2010 1:58 AM Page 148
Retinal Function
Chi D. Luu* and Audrey W.L. Chia
†,‡
Introduction
Myopia, or short sightedness, is a condition where the refractive apparatus
of the eye, the cornea, and lens, focus the image of distant objects in front
of the retina.
Myopia is often associated with an increase in axial length, however, it
is unclear whether anatomical changes as a result of axial elongation have
any effect on retinal function. This chapter summarizes the existing liter-
ature on the effect of myopia on the function of various retinal compo-
nents, including the photoreceptors, post-receptoral bipolar cells, and the
inner retinal component. The central retinal function in myopia and its
potential role for predicting the rate of myopia progression in children will
also be discussed. This chapter will cover only those studies involving
human subjects and that use electrophysiological techniques for the
assessment of retinal function.
Electroretinography
Electroretinography is a technique used to study the physiology of both
neuronal and non-neuronal cells in the retina. There are a number of elec-
troretinography techniques, but only Ganzfeld electroretinography and the
multifocal electroretinography will be described here, because they are the
most commonly used as means to assess retinal function in myopic eyes.
149
2.5
*Centre for Eye Research Australia, The University of Melbourne, Royal Victorian Eye and Ear Hospital,
Melbourne, Victoria, Australia. E-mail: [email protected]!yahoo.com.au

Singapore Eye Research Institute, Singapore.

Singapore National Eye Centre, Singapore.
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 149
Ganzfeld electroretinography
Ganzfeld or full-field electroretinography (ERG) has been well-recognized
as a useful and non-invasive tool for objective assessment of retinal
function. The ERG response is a mass electro-retinal potential generated
by various retinal cell types whose relative contributions depend on the
stimulus properties and background adapting conditions. For example,
under dark-adapted conditions, the ERG response to a bright flash stimu-
lus manifests an a- and b-wave that primarily reflects the activity of
photoreceptors (a mix of rods and cones) and depolarizing bipolar cells,
respectively. The ERG response to a bright flash under light-adapted
condition is derived from the activities of only cone photoreceptors and
cone bipolar cells.
The standard protocol for full-field ERG as defined by the International
Society for the Clinical Electrophysiology of Vision (ISCEV) consists of
five responses (Fig. 1); scotopic response (derived from the rod sys-
tem), maximal response (derived from rod and cone receptors and post-
receptoral activities), oscillatory potentials (derived from inner retinal
and amacrine cells), photopic single flash response (shaped by cone
photoreceptors and post-receptoral activities), and response to 30 Hz
flicker (cone bipolar cell function).
1
Thus, the function of different layers
150 C. D. Luu and A. W. L. Chia
Figure 1. Five standard responses of the full-field ERG.
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 150
of the retina can be assessed from the responses obtained, and the pat-
tern of abnormality from these five responses enables us to identify the
retinal site of the lesion. Because the ERG records a mass retinal poten-
tial, it is useful in diseases that affect the retina globally (e.g. retinitis pig-
mentosa), but it is not sensitive enough to detect those conditions
associated with subtle or localized functional changes within the retina
(e.g. macular degeneration).
Multifocal electroretinography
Unlike full-field ERG, multifocal ERG (mfERG) can record responses from
more than 100 different retinal locations simultaneously and provide a
detailed functional topography of the retina (Fig. 2).
2,3
Thus, mfERG is
more sensitive than full-field ERG in detecting a localized retinal dysfunc-
tion. The mfERG response waveform has three major components, namely
N1 (first negative trough), P1 (first positive peak), and N2 (second
negative trough). The clinical applications of mfERG have been widely
recognized,
4
and mfERG has been proven to be a sensitive technique for
the early detection of retinal dysfunction in various conditions including
diabetic retinopathy
5–7
and retinal toxicity.
8
151 Retinal Function
Figure 2. Trace array response of the mfERG superimposition on a fundus photograph
(left), demonstrating the functional topography feature of mfERG. The mfERG wave-
form was enlarged (right) to illustrate different components of the mfERG response.
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 151
Assessment of Retinal Function
By using our knowledge of the origin of various components of the
electroretinography response, we are able to assess the effect of myopia on
different retinal layers and regions in turn.
Outer retinal (photoreceptor) function
The ERG a-wave response amplitude is reduced in adults with myopia,
9,10
indicating the presence of abnormal outer retinal (photoreceptors) func-
tion in adult myopic eyes. The relationship between ERG amplitude and
severity of myopia is best described by a linear function. The amplitude of
the ERG a-wave is positively correlated with the severity of myopia
9
and
inversely correlated with the axial length.
10,11
The affect of myopia on the function of each individual cone type was
investigated by Yamamoto et al.
12
using specialized ERG technique. In their
study, the ERG was recorded with chromatic stimuli obtained with various
colored filters. The results showed that short- (S), medium- (M), and
long-wavelength (L) sensitive cone response amplitudes decreased with
increasing myopia, however, a more significant correlation was detected
between the L,M-cone response amplitude and refractive error than
between the S-cone response amplitude and refractive error.
12
These
findings suggest that the L,M-cones are possibly more affected than the
S-cones in myopia.
Post-receptoral (bipolar cell) and retinal
transmission function
Many studies have shown that the ERG b-wave response amplitude is
decreased with increasing myopia.
9–11
Similar to that of the ERG a-wave
response, the b-wave response amplitude is positively correlated with the
severity of myopia
9
and inversely associated with the axial length.
10,11
The interpretation of the b-wave reduction in myopia is not as
straightforward as that of the a-wave. Although the ERG b-wave ampli-
tude has been reported to be consistently reduced in eyes with myopia,
this does not necessarily imply that there is a presence of abnormal
transmission between the outer and middle retina, or post-receptoral
dysfunction. This is because reduction of the a-wave amplitude will cause
a proportionate reduction of the b-wave amplitude. In order to examine
152 C. D. Luu and A. W. L. Chia
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 152
the retinal transmission abnormality, a b-/a-wave amplitude ratio should
be investigated.
Perlman et al. reported that all myopic eyes in their study had subnor-
mal ERG b-wave amplitude, but normal b-/a-wave amplitude ratios sug-
gest that myopic eyes have normal signal transmission in the retina.
10,13
However, Pallin et al.
9
reported that the higher the myopia, the smaller the
b-/a-wave amplitude ratio, although these ratios were within the normal
range. Pallin et al. believed that signal transmission in the retina tends to
be somewhat reduced in an eye with high myopia.
Inner retinal function
Abnormal oscillatory potentials (OPs) and retinal adaptation in eyes with
myopia have been reported in a number of studies.
11,14
Chen et al.
15
investigated retinal adaptation in eyes with myopia using a global flash
paradigm of the mfERG. They showed that retinal adaptation varied with
the degree of myopia. The abnormal OP and retinal adaptation are
thought to be linked to the hypothesis that dopamine may play a role in
the development of myopia.
It has been shown in animal models of myopia that dopamine, a
neurotransmitter released by the inner retina, is associated with the devel-
opment of myopia.
16,17
Dopamine is an important chemical messenger for
amacrine cell and retinal ganglion cell processing and is involved in the
process of retinal luminance adaptation.
18
Retinal amacrine cells have also
been shown to play an important role in the modulation and control of
ocular growth.
19–22
The retinal oscillatory potentials (OPs) of the ERG
reflect the amacrine cell function, hence, abnormal OPs in myopia have
been suggested to be related to the changes in dopamine level within the
inner retina associated with myopia. However, the presence of outer retinal
dysfunction, which is commonly seen in eyes with myopia, can cause an
apparent abnormal inner retinal ERG parameter, including the OPs.
Therefore, the association between abnormal OPs and myopia needs to be
interpreted with caution, because it is possible that the abnormal OPs were
due to the presence of abnormal outer retinal function.
Macular function in myopic retina
The macular function of eyes with myopia has been investigated
by a number of groups using the multifocal ERG (mfERG).
23–27
There was
153 Retinal Function
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 153
a significant correlation between first-order kernel mfERG responses and
refractive error. The findings showed that the amplitude of the mfERG
decreased as the degree of myopia increased. The mfERG P1 amplitude is
negatively correlated with the axial length. The mfERG P1 implicit time
increased with an increase in axial length and severity of myopia.
Effect of Long-Term Atropine Usage on Retinal Function
To date, only atropine eye drops have been shown to have a consistent
effect on the retardation of myopia progression.
28,29
There are, however, at
least two potential chronic side effects associated with the long-term use of
atropine. Firstly, accumulation of atropine over a period of time might be
toxic to the neural retina. Secondly, constant pupillary dilatation will
increase the amount of light entering the eye and could theoretically cause
photic damage to the retina.
Luu et al.
30
recorded the mfERG responses in children (n = 48) receiv-
ing atropine eye drops once daily for two years, and in those receiving
placebo eye drops (n = 57) for a similar duration. Their results showed that
there was no significant difference in the mfERG response amplitudes and
implicit times between the atropine treated and placebo control groups,
suggesting that atropine use for two years has no significant effect on reti-
nal function.
Macular Function Associates with Myopia Progression
Studies have examined the relationship between macular function changes
and the rate of myopia progression. Chen et al.
14
studied the multifocal
oscillatory potential (mfOP) changes in emmetropes, stable myopes, and
progressing myopes. They found that progressing myopes had signifi-
cantly shorter mfOP implicit times compared to emmetropes and stable
myopes. There were, however, no statistically significant differences in OP
amplitudes between the groups.
Luu et al.
31
examined the mfERG responses of 81 children (aged 9–10
years) with myopia (mean spherical equivalent refraction ranging from
−1.00 D to −5.88 D), and they showed that the initial mfERG P1 amplitude
within the central 5 degrees was significantly associated with the subse-
quent two-year myopia progression rate, but not with the initial degree of
154 C. D. Luu and A. W. L. Chia
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 154
myopia. The mfERG P1 amplitude of the central ring was significantly
reduced in a high progression group, defined as a progression rate of at
least 1 D per two years, compared to a medium progression group (pro-
gression rate of >0.25 D and <1 D per two years) or a low/no progression
group (progression rate of ≤0.25 D per two years). Responses from rings
2–5 (central 5 to 35 degrees retina) were similar for all the progression
groups. No significant differences in mfERG response implicit times were
found in any of the progression groups at any of the locations tested.
Factors Associated with ERG Changes in Myopia
Although the reduction in ERG response in adults with myopia has been
well recognized, the actual mechanisms of ERG reduction in myopia are
unclear.
It has been suggested that the reduction in ERG amplitudes seen in
adults with myopia may be owing to a reduced image size and decreased
retinal illumination, known as the optical factor, as a result of axial elon-
gation of the eye.
32
By examining the stimulus intensity response function,
Kawabata and Adachi-Usami
23
claimed that decreased retinal illuminance
did not explain the reduced ERG response because the responses of the
high-myopic eye had much lower saturated amplitudes than for the
emmetropic eye.
It has been suggested that the ERG amplitudes are reduced in persons
with myopia because of a higher resistance between the source of the
current (the retina) and the place where the current is measured (the
cornea). It is believed that increased distance between the electrical
source and the recording corneal electrode, also referred to as the electri-
cal factor, due to a larger eyeball, caused an increase in the ocular resist-
ance to electric current.
9,33
Decreased retinal photoreceptor density, morphological changes in the
photoreceptor outer segment, and photoreceptor dysfunction have been
postulated as the causes for ERG reduction in myopia.
24,34
Altered neural
processing could result, in part, from retinal stretching in the enlarged
myopic eye, which may produce both increased retinal cell spacing and
post-receptoral retinal dysfunction, and lead to a decrease in retinal
sampling.
34
Another mechanical attribute of the eye in axial myopia might
be an increase in the subretinal space and subsequent reduction in pho-
toreceptor response.
34
155 Retinal Function
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 155
Luu et al.
25
examined the relationship between ERG amplitude and
myopia in adults and children with various degrees of myopia. While their
results confirm that there is a significant correlation between the refractive
error and ERG amplitude in adults with myopia, they also discovered that
such a relationship is absent in children with myopia. In light of the results
obtained from this study, the optical and electrical factors are unlikely to
be the cause of the ERG reduction because of the absence of any relation-
ship between ERG amplitudes and the severity of myopia in children.
Similarly, with photoreceptor morphological and functional changes in
myopic eyes, a good correlation between ERG amplitude reduction and
severity of myopia would be expected irrespective of the subject’s age.
These data provide strong evidence that the reduction of ERG response
seen in adults with myopia is not directly due to the severity of myopia.
The lack of correlation between ERG amplitude and the degree of myopia
in children suggest that other mechanisms must be responsible for the
reduction in ERG. It is postulated that the reduction in ERG response seen
in the adult group may be owing to retinal function modifications that are
associated with long-standing myopia.
Conclusion
There are demonstrable changes in retinal function in subjects with
myopia. In studies involving Ganzfield electroretinography, there is a
progressive reduction in both a-wave (photoreceptor) and b-wave (bipolar
cell) responses in adult subjects with increasing myopia, and reduction
in b-/a-wave amplitude ratio in those with very high myopia. Similar
reduction in P1 responses of the mfERG were seen in the macular
regions. The exact nature of ERG reduction in myopia remains unknown.
Gradual changes do occur in myopic fundi over time with the develop-
ment of posterior staphyloma, peripalliary atrophy, and myopic macular
degeneration, and there may be clinically significant visual loss in some
individuals.
Future directions include a better understanding on what, when, and
where functional changes occur within the myopic retina over time. Of
interest is also whether these changes precede or even induce anatomical
changes and whether they can be used to identify individuals at greatest
risk of developing high myopia. Electroretinography can also be used to
156 C. D. Luu and A. W. L. Chia
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 156
monitor the safety and efficacy of new drug therapies for myopia as they
become available in the future.
References
1. Marmor MF, Fulton AB, Holder GE, et al. (2009) ISCEV Standard for full-
field clinical electroretinography (2008 update). Doc Ophthalmol 118: 69–77.
2. Hood DC. (2000) Assessing retinal function with the multifocal technique.
Prog Retin Eye Res 19: 607–646.
3. Sutter EE, Tran D. (1992) The field topography of ERG components in
man — I. The photopic luminance response. Vision Res 32: 433–446.
4. Lai TY, Chan WM, Lai RY, et al. (2007) The clinical applications of multifocal
electroretinography: A systematic review. Surv Ophthalmol 52
:
61–96.
5. Bearse MA Jr, Adams AJ, Han Y, et al. (2006) A multifocal electroretinogram
model predicting the development of diabetic retinopathy. Prog Retin Eye Res
25: 425–448.
6. Han Y, Bearse MA Jr, Schneck ME, et al. (2004) Multifocal electroretinogram
delays predict sites of subsequent diabetic retinopathy. Invest Ophthalmol Vis
Sci 45: 948–954.
7. Han Y, Schneck ME, Bearse MA Jr, et al. (2004) Formulation and evaluation
of a predictive model to identify the sites of future diabetic retinopathy. Invest
Ophthalmol Vis Sci 45: 4106–4112.
8. Lai TY, Chan WM, Li H, et al. (2005) Multifocal electroretinographic changes in
patients receiving hydroxychloroquine therapy. Am J Ophthalmol 140: 794–807.
9. Pallin E. (1969) The influence of the axial size of the eye on the size of the
recorded b-potential in the clinical single-flash electroretinogram. Acta
Ophthalmol 101(suppl): 1–57.
10. Perlman I, Meyer E, Haim T, Zonis S. (1984) Retinal function in high refrac-
tive error assessed electroretinographically. Br J Ophthalmol 68: 79–84.
11. Westall CA, Dhaliwal HS, Panton CM, et al. (2001) Values of electroretino-
gram responses according to axial length. Doc Ophthalmol 102: 115–130.
12. Yamamoto S, Nitta K, Kamiyama M. (1997) Cone electroretinogram to chro-
matic stimuli in myopic eyes. Vision Res 37: 2157–2159
13. Perlman I. (1983) Relationship between the amplitudes of the b wave and the
a wave as a useful index for evaluating the electroretinogram. Br J Ophthalmol
67: 443–448.
14. Chen JC, Brown B, Schmid KL. (2006) Evaluation of inner retinal function in
myopia using oscillatory potentials of the multifocal electroretinogram.
Vision Res 46: 4096–4103.
157 Retinal Function
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 157
15. Chen JC, Brown B, Schmid KL. (2006) Retinal adaptation responses revealed
by global flash multifocal electroretinogram are dependent on the degree of
myopic refractive error. Vision Res 46: 3413–3421.
16. Megaw PL, Morgan IG, Boelen MK. (1997) Dopaminergic behavior in
chicken retina and the effect of form deprivation. Aust N Z J Ophthalmol
25(Suppl 1): S76–S78
17. Stone RA, Lin T, Laties AM, Luvone PM. (1989) Retinal dopamine and form-
deprivation myopia. Proc Natl Acad Sci USA 86: 704–706.
18. Witkovsky P. (2004) Dopamine and retinal function. Doc Ophthalmol
108: 17–40.
19. Feldkaemper MP, Schaeffel F. (2002) Evidence for a potential role of glucagon
during eye growth regulation in chicks. Vis Neurosci 19: 755–766.
20. Laties AM, Stone RA. (1991) Some visual and neurochemical correlates of
refractive development. Vis Neurosci 7: 125–128.
21. Pendrak K, Nguyen T, Lin T, et al. (1997) Retinal dopamine in the recovery
from experimental myopia. Curr Eye Res 16: 152–157.
22. Raviola E, Wiesel TN. (1990) Neural control of eye growth and experimental
myopia in primates. Ciba Found Symp 155: 22–38; discussion 39–44.
23. Kawabata H, Adachi-Usami E. (1997) Multifocal electroretinogram in
myopia. Invest Ophthalmol Vis Sci 38: 2844–2851.
24. Chan HL, Mohidin N. (2003) Variation of multifocal electroretinogram with
axial length. Ophthalmic Physiol Opt 23: 133–140.
25. Luu CD, Lau AM, Lee SY. (2006) Multifocal electroretinogram in adults and
children with myopia. Arch Ophthalmol 124: 328–334.
26. Chen JC, Brown B, Schmid KL. (2006) Delayed mfERG responses in myopia.
Vision Res 46: 1221–1229.
27. Wolsley CJ, Saunders KJ, Silvestri G, Anderson RS. (2008) Investigation
of changes in the myopic retina using multifocal electroretinograms,
optical coherence tomography and peripheral resolution acuity. Vision Res 48:
1554–1561.
28. Chua WH, Balakrishnan V, Chan YH, et al. (2006) Atropine for the treatment
of childhood myopia. Ophthalmology 113: 2285–2291.
29. Saw SM, Shih-Yen EC, Koh A, Tan D. (2002) Interventions to retard myopia
progression in children: an evidence-based update. Ophthalmology 109:
415–421; discussion 422–414; quiz 425–416, 443.
30. Luu CD, Lau AMI, Koh AHC, et al. (2003) Effects of long-term atropine usage
on retinal function. Invest Ophthalmol Vis Sci 44(Suppl 2): U646 (Meeting
Abstract 4790).
31. Luu CD, Foulds WS, Tan DT. (2007) Features of the multifocal electroretino-
gram may predict the rate of myopia progression in children. Ophthalmology
114: 1433–1438.
158 C. D. Luu and A. W. L. Chia
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 158
32. Palmowski AM, Berninger T, Allgayer R, Andrielis H, Heinemann-Vernaleken B,
Rudolph G. (1999) Effects of refractive blur on the multifocal electroretinogram.
Doc Ophthalmol 99: 41–54.
33. Lemagne JM, Gagne S, Cortin P. (1982) Resistance in clinical electroretinog-
raphy: Its role in amplitude variability. Can J Ophthalmol 17: 67–69.
34. Atchison DA, Schmid KL, Pritchard N. (2006) Neural and optical limits to
visual performance in myopia. Vision Res 46: 3707–3722.
159 Retinal Function
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 159
b846_Chapter-2.5.qxd 4/8/2010 1:58 AM Page 160
This page intentionally left blank This page intentionally left blank
Genetics of Myopia
Section 3
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 162
This page intentionally left blank This page intentionally left blank
New Approaches in the Genetics of Myopia
Liang K. Goh*, Ravikanth Metlapally

and Terri Young*
,†
Introduction
Myopia is the most common human ocular disorder, and its public
health and economic impact is significant.
1–3
The prevalence of myopia
varies across different populations and ethnicities. Myopia prevalence in
some Asian countries has reached epidemic proportions, e.g. affecting
approximately 82% of medical students in Singapore
4
and 90% of high
school children in Taiwan.
5
Chinese and Japanese populations also have
high myopia prevalence rates of > 50–70%.
6,7
One-third of the U.S. adult
population has some degree of myopia.
8
Asians in the United States have
a higher prevalence than Caucasians or African Americans.
9
Ashkenazi
Jews, especially Orthodox Jewish males, have shown a higher prevalence
than other American Caucasians or European populations.
10
Pathologic
or high myopia (refractive spherical dioptric power of –5 or worse) affects
approximately 2% of the general population,
1,9
and is a major cause of
legal blindness given the increased risks of associated co-morbidities
of choroidal neovascularization (CNV), retinal detachment (RD), and
glaucoma.
11,12
Multiple studies provide compelling evidence that myopia is inherited.
Familial aggregation studies report a positive correlation between parental
myopia and myopia in their children, indicating a hereditary influence in
myopia susceptibility.
13,14
Multiple familial studies also support a definite
genetic basis for myopia.
15–18
Twin studies estimate a notable high heri-
tability value between 0.5–0.96 (the proportion of the total phenotypic
variance that is attributed to genetic variance).
19,20
163
3.1
*Duke-National University of Singapore Graduate Medical School, Singapore. E-mail: [email protected]
duke-nus.edu.sg

Duke Center for Human Genetics, Durham NC.
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 163
Human molecular genetic studies to understand the pathogenesis of
non-syndromic myopia have been carried out over the last two decades.
These include mapping studies with relatively small number of families
affected by pathologic myopia and large family-based/case-control genetic
association studies based on positional candidate gene approach. The first
study to define a genetic interval for myopia on chromosome Xq28
(MYP1, OMIM 310460) was regarding an X-linked recessive form of high
myopia named the Bornholm (Denmark) Eye Disease (BED), the pheno-
type that also included cone dysfunction.
21
Since then, numerous loci have
been identified for non-syndromic myopia, a detailed list of which is
shown in Table 1. The loci on chromosomal regions Xq28, 2q37, 12q21,
18p11, and 22q12 have been replicated independently
22–28
as several new
ones are being discovered. The involvement of multiple loci suggests that
myopia development perhaps is driven by polygenic influences. This
notion was corroborated by Klein et al. in their investigation of familial
aggregation and pattern of inheritance of ocular refraction in a large
cohort (data from the Beaver Dam Eye Study).
16
Single nucleotide polymorphism association studies or genome-wide
association studies (GWAS) in myopia genetics research have burgeoned
in recent years. The approach has been widely used for the discovery of
genetic variants associated with common diseases such as bipolar disorder,
type 2 diabetes, Crohn’s disease, and cancer.
29–32
This has been made pos-
sible by the completion of the Human Genome and HapMap projects as
well as development of high-throughput genotyping technology for inter-
rogating thousands of single nucleotide polymorphisms (SNPs). In these
studies, SNPs across the genome are genotyped and each marker is ana-
lyzed individually for association with the trait. It is based on the rationale
that some of these markers that are observable (or genotyped) are in link-
age disequilibrium with the quantitative trait locus (QTL) which is often
not observable or typed. This simple approach of ‘association by guilt’ has
led to the discovery of novel disease susceptible genes.
To date, approximately 15 genes have been positively associated with
myopia disease status — a list of these is shown in Table 2. In these stud-
ies, establishing replication in independent and/or diverse datasets is crit-
ical for success in identifying the causative gene/s. While there are studies
that have reported lack of association between myopia and some of the
listed genes in Table 2,
33–40
the reasons for the lack of association can be
multifold (sample size, study design, heterogeneity, etc). Since inconsistent
and incompatible results can act as a hindrance to gene discovery, we
164 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 164
1
6
5
N
e
w

A
p
p
r
o
a
c
h
e
s

i
n

t
h
e

G
e
n
e
t
i
c
s

o
f

M
y
o
p
i
a
Table 1. List of Genetic Loci for Myopia. OMIM — Online Mendelian Inheritance in Man, D-diopter
Locus OMIM Location Reference Study Myopia Severity Age of Onset
MYP1 310460 Xq28 Schwartz, et al. 1990 High: –6.75 D to –11.25 D Early: 1.5 to 5 years
MYP2 160700 18p11.31 Young, Ronan, Drahozal, High: –6 D to –21 D Early: 6.8 years (average)
et al. 1998
MYP3 603221 12q21 – q23 Young, Ronan, Alvear High: –6.25 D to –15 D Early: 5.9 years (average)
et al. 1998
MYP4 608367 7q36 Naiglin, et al. 2002 High: –13.05 D (average) n/a
MYP5 608474 17q21 – q22 Paluru, et al. 2003 High: –5.5 D to –50 D Early: 8.9 years (average)
MYP6 608908 22q12 Stambolian, et al. 2004 Mild-moderate: –1.00 D n/a
or lower
MYP7 609256 11p13 Hammond, et al. 2004 –12.12 D to +7.25 D n/a
MYP8 609257 3q26 Hammond, et al. 2004 –12.12 D to +7.25 D n/a
MYP9 609258 4q12 Hammond, et al. 2004 –12.12 D to +7.25 D n/a
MYP10 609259 8p23 Hammond, et al. 2004 –12.12 D to +7.25 D n/a
MYP11 609994 4q22 – q27 Zhang, Guo, et al. 2005 High: –5 D to –20 D Early: before school age
MYP12 609995 2q37.1 Paluru, et al. 2005 High: –7.25 D to −27 D Early: before 12 years
(Continued)
b
8
4
6
_
C
h
a
p
t
e
r
-
3
.
1
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
8

A
M


P
a
g
e

1
6
5
1
6
6
L
.
K
.

G
o
h
,

R
.

M
e
t
l
a
p
a
l
l
y

a
n
d

T
.

Y
o
u
n
g
Table1. (Continued)
Locus OMIM Location Reference Study Myopia Severity Age of Onset
MYP13 300613 Xq23 – q25 Zhang, Guo, et al. 2006 High: –6 D to –20 D Early: before school age
MYP14 610320 1p36 Wojciechowski R, Moy C, Moderate to high: –3.46 D n/a
et al. 2006 (average)
MYP15 612717 10q21.1 Nallasamy, et al. 2007 High: –7.04 D (average) Early: 6 to 16 years
MYP16 612554 5p15.33−p15.2 Lam, et al. 2008 High: –7.13 D to –16.86 D n/a
(range of averages)
MYP? — 1q41 Klein, et al. 2007 Range of refractive errors n/a
MYP? — 7p21 Klein, et al. 2007 Range of refractive errors n/a
MYP? — 22q11.23 – 12.3 Klein, et al. 2007 Range of refractive errors n/a
MYP? — 7p15 Ciner, et al. 2008 Moderate to high: –2.87 D n/a
(average)
MYP? — 3q26 Andrew T, et al. 2008 Range: –20 D to +8.75 D n/a
MYP? — 20q11.23 – 13.2 Ciner, et al. 2009 Moderate to high: –4.39 D n/a
and –4 D, averages
MYP? — 9q34.11 Li, et al. 2009 High: –5 D or worse Early: school age
b
8
4
6
_
C
h
a
p
t
e
r
-
3
.
1
.
q
x
d


4
/
8
/
2
0
1
0


1
:
5
8

A
M


P
a
g
e

1
6
6
167 New Approaches in the Genetics of Myopia
Table 2. List of Genetic Association Studies of Genes with Positive Association with
Myopic Refractive Error States. PMID — PubMed Unique Identifier. D-diopter
Gene Study PMID Ethnicity Degree of Myopia
CHRM1 Lin HJ, et al. 2009 19753311 Taiwanese High
Lumican Lin HJ, et al. 2009 19643966 Taiwanese High
Lumican Chen ZT, et al. 2009 19616852 Taiwanese High
cMET Khor, et al. 2009 19500853 Chinese Any
HGF Yanovitch, et al. 19471602 Caucasian Mild to moderate
2009
COL2A1 Metlapally, et al. 19387081 Caucasian High
2009
TGFb1 Zha Y, et al. 2009 19365037 Chinese High (

8.00 D
or more)
MMP-1 Hall NF, et al. 2009 19279308 Caucasian Any
MMP-3 Hall NF, et al. 2009 19279308 Caucasian Any
MMP-9 Hall NF, et al. 2009 19279308 Caucasian Any
MYOC Vatavuk Z, et al. 19260140 Croatia High
2009
PAX6 Han W, et al. 2009 19124844 Han Chinese High
PAX6 Tsai YY, et al. 2008 17948041 Chinese Extreme (–10.00 D
Taiwanese or more)
PAX6 Hewitt AW, et al. 17896318 Caucasian High
2007
COL2A1 Mutti DO, et al. 17653045 Caucasian Any
2007
COL1A1 Inamori Y, et al. 17557158 Japanese Extreme (–9.25 D
2007 or more)
MYOC Tang WC, et al. 17438518 Chinese High
2007
Lumican Majava M, et al. 17117407 English and High
2007 Finnish
FMOD Majava M, et al. 17117407 English and High
2007 Finnish
PRELP Majava M, et al. 17117407 English and High
2007 Finnish
OPTC Majava M, et al. 17117407 English and High
2007 Finnish
Lumican Wang IJ, et al. 16902402 Taiwanese Extreme (–10.00 D
2006 or more)
TGFb1 Lin HJ, et al. 2006 16807529 Chinese High
Taiwanese
HGF Han W, et al. 2006 16723436 Han Chinese High
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 167
believe new approaches such as integrating genomic information with
quantitative analyses to prioritize loci or genes of interest will streamline
the gene discovery process and improve statistical power. Two approaches
are reviewed in this chapter: genomic convergence and pathway analysis.
Genomic Convergence Using Genomic Content
Genomic convergence refers to the integration of genomic information
with quantitative analyses to prioritize loci or genes of interest.
41,42
Quantitatively, it gives weight to the role of biological relevance of the loci,
taking into consideration the genomic properties, functionality, gene
expression as well as evidence of association reported in literature. It is a
multi-factorial, multi-step approach toward discovery of candidate sus-
ceptibility genes for diseases. The idea was first applied on a linkage study
for Parkinson disease (PD).
41
In the study, gene expression using serial
analysis of gene expression (SAGE) was integrated or mapped with loci
from linkage analyses. As fewer than 10% of linkage regions are actually
expressed, the approach resulted in significant wet laboratory effort. While
GWAS are powerful for identifying susceptible loci associated with dis-
eases, the number of candidate loci presented and the high false positives
pose challenges in discovery of genes that are involved in the disease. By
complementing this with genomic information available in databases and
literature, and converging this information using a quantitative approach,
a comprehensive analysis of the significant role candidate loci can play in
the biological pathway of the disease can be developed.
One of the challenges in genomic convergence is the mapping or
integration of different sources of information. The most common
mapping framework exists in the genome databases that have been set up
by several key genome groups such as the University of California Santa
Cruz (UCSC), National Center for Biotechnology Information (NCBI)
(http://www.ncbi.nlm.nih.gov/), and European Bioinformatics Institute
(EBI) (http://www.ebi.ac.uk/). The genome databases that have been
developed to collate information in a structured and easily visualized
framework to aid researchers have been instrumental in new discovery.
Three most popular genome databases are the UCSC Genome Browser
((http://genome.ucsc.edu/), EBI Ensembl Genome Browser (http://www.
ebi.ac.uk/ensembl/), and NCBI MapViewer (http://www.ncbi.nlm.nih.gov/
projects/mapview/). All browsers allow multiple and simultaneous
168 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 168
display of annotations in a single window. Additionally, they also allow
query and retrieval of data from underlying databases that support the
browsers.
The genomic content in the UCSC Genome Browser is organized into
several groups, each consisting of relevant tracks with provision for cus-
tomized tracks using various established formats such as BED (positions
of data items in a standard UCSC Browser format) or WIG (allows the dis-
play of continuous-valued data in a track format). There are other tools
for further analyses of the data, one of which is the Table Browser. It is a
portal to the relational database underlying the browser, allowing query
and retrieval of information through structured query. From this portal,
relevant genomic information can be elicited for genomic convergence.
Information that may be useful for genomic convergence in GWAS is: gene
and regulatory functionality, linkage disequilibrium, and allele specific
information. In addition, genomic information from other databases spe-
cific to the disease can also be included. In our association study for
myopia (manuscript submitted), we have converged the myopia loci
shown in Table 1 and the EyeSAGE
43
database (which contains a rich set of
reported loci and corresponding gene expression using SAGE) together
with our GWAS to help prioritize the markers. Figure 1 shows an example
of the convergence of GWAS p-values with genomic information in the
UCSC Genome Browser.
Pathway Analysis
Pathway analysis in cancer genomics
Pathway analysis, sometimes synonymously known as Gene Set
Enrichment Analysis (GSEA), comprises of statistical methods developed
in the field of cancer genomics for expression-based annotations.
44–50
It
utilizes biological pathway information in discovery of candidate genes.
Diseases are often regulated by networks of genes or gene sets, each con-
ferring a small effect on the overall phenotype. Traditional data mining or
statistical approaches may not capture the small effects of these genes on
the disease. Such genetic heterogeneity common in many complex human
diseases can lead to the loss of power to detect genetic associations using
single marker analyses due to weak marginal effects and multiple testing
corrections.
51
169 New Approaches in the Genetics of Myopia
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 169
170 L.K. Goh, R. Metlapally and T. Young
Fig. 1. Genomic convergence of GWAS p-values with genomic information on the UCSC
Genome Browser. The top track shows the GWAS p-values followed by the other tracks
available in the browser such as Genetic Association Studies of Complex Diseases and
Disorders (GAD), Human Quantitative Trait Locus (RGD Human QTL), UCSC Genes, Gene
Expression Atlas Ratios (GNF Ratio), CpG Islands, TS miRNA sites (TargetScan miRNA
Regulatory Sites), 7X Reg Potential (Regulatory Potential), Mammal Cons (PhastCons
Conservation), SNPs, Linkage Disequilibrium, Database of Genomic Variants (DGV), and
ENCODE regions.
In pathway analyses, statistical methods are used to compute the com-
bined statistics of genes and then assess the significance of these genes in
gene sets or pathways. It involves two steps: score statistics for each gene
set and assessment of the significance of the gene sets with annotated
pathways. For score statistics, Subramanian et al.
48
and Mootha et al.
44
calculated an enrichment score for each gene set by ranking the genes
based on their association with the phenotype. Tian et al.
46
and Kim and
Volsky
47
used two sample statistics such as t-test for each gene and aggre-
gate it for every gene set. A difference in these methods is the treatment of
genes that are not in the gene set. One approach is to apply penalties on
the non-member genes
44,48
and the other is to ignore it.
46
To assess signifi-
cance of the statistics, most of these methods use nonparametric statistics
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 170
such as permutation to measure the significance of overlapped genes with
those in annotated gene sets. Pathway analyses and GSEA have been
successfully applied in many studies involving basic science, clinical stud-
ies, and pathway deregulation in cancer biology.
52–54
Pathway analysis in GWAS
Single marker-based association tests suffer from low power if each tested
marker is in incomplete LD with the unobserved or untyped QTL. This
has led to the development of multi-locus analysis, which considers the
joint effects of markers simultaneously. It can be performed on the basis
of either genotype or haplotype. Instead of single marker-based associa-
tion with the trait, a group of markers are assessed for association with the
trait. For genotype analysis, the approach typically uses multi-linear
regression to model the relationship between the traits and a vector of
covariates corresponding to the genotypes or similarity between pairs of
genotypes. Intuitively, this should provide greater power to detect QTL,
but due to the large number of degrees of freedom in multivariate test sta-
tistics, simulation studies have shown similar or reduced power compared
with single-marker analyses. Several novel statistical approaches (para-
metric and non-parametric) have been developed to overcome this. One
approach is a dimension-reduction procedure, such as principal compo-
nent analysis
55,56
or Fourier transformation
57
to reduce the genetic data,
while another uses kernel functions to reduce the score statistics to a global
statistic,
58–61
all resulting in a smaller degree of freedom.
An alternative to genotype analysis mentioned above is combining p-
values from single marker-based association tests.
62–64
It has two steps, just
as in the pathway analysis or GSEA approaches for cancer genomics. The
first involves robust methods on combining test statistics from multiple
markers or SNPs into meaningful statistics for genes in a pathway. These
can then be tested against the null hypothesis that the gene sets are not
clustered by chance. Instead of focusing on a few markers with strongest
associations with the disease, the biological relevance of the markers as
captured in pathways is considered. It is still a relatively new approach for
GWAS though encouraging results have been shown in several studies.
65–68
Lastly, haplotype association tests offer a higher dimension of analyses
and may identify markers with small genetic effects that could otherwise
be missed out in single marker tests. However, phase information of hap-
lotypes is not easily available, and though it can be inferred statistically, it
171 New Approaches in the Genetics of Myopia
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 171
introduces some uncertainty that leads to an inflated statistics variance
and therefore reduces power.
69
As in multi-locus analysis, it suffers from a
large degree of freedom. Haplotype analysis is also limited to within a
chromosome, which does not necessarily make biological sense since
genes within a given pathway are often from different chromosomes. As
the focus of this review is pathway analysis, we refer readers to a compre-
hensive review of haplotype analysis by Salem et al.
70
A discussion of hap-
lotype and genotype-based analysis can also be found in Clayton et al.
69
In the following sections, we review the multi-locus methods that have
been developed to enable pathway analysis in GWAS. As highlighted, they
can be categorized as non-parametric, parametric, and p-values combin-
ing approaches.
Non-parametric approaches
A non-parametric method was proposed by Schaid et al.
58
using U-
statistics
71
to compute a global statistic for pair-wise comparison of geno-
types between samples using kernel functions that describe the dosage
effects of additive, dominant, recessive, quadratic, or allelic models.
where g
i,k
and g
j,k
are the kth genotype of samples i and j, h(g
i
, g
j
) is the
kernel function and there are N samples and K markers. w
k
is the weight
for k markers, which is estimated from the covariance matrix of U. The
statistical test consists of comparing the global statistics between cases and
controls. The statistical power of the test is thus dependent on the choice
of kernel functions and the resultant is a loss of power when an inappro-
priate kernel is used. In simulation, the quadratic kernel has been shown
to be robust and is thus a reasonable choice when the underlying genetic
effect is unknown. Do note that the performance of the method is also
influenced by the accumulated noise from an increased number of SNPs.
The test statistics may deteriorate when too many SNPs in the K markers
are not associated with the trait.
57
An alternative U-statistics was proposed by Wei et al.,
60
looking at the
within and between-group U-statistics instead of the contrast between
cases and controls. This allows for qualitative traits of more than two
categories and can be extended to quantitative traits as well. Instead of the
U
w h g g
k i k j k
k i j
n
global
=
∑ ∑
<
( , )
( )
, ,
2
172 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 172
kernel functions used by Schaid et al.,
58
a Hamming distance kernel was
implemented. w
k
is SNP-specific and defined as the negative logarithm of
the single marker p-value.
Under the null hypothesis, U
between
is zero so the test statistics is defined as:-
Simulation shows the U-statistics by Wei et al.
60
is comparable with that
of Schaid et al.
58
for additive and multiplicative models. The more inter-
esting result is the scenario where there are protective and predisposing
effects among the multiple markers; Wei et al. shows marked improve-
ment. It should be noted that the comparison with Schaid et al. was imple-
mented using the linear dosage kernel that was acknowledged by the
author to suffer from poor power when the minor alleles were both
protective and disease predisposing across multiple markers. The quad-
ratic kernel that showed robustness could have been used for a more
comprehensive comparison.
One of the drawbacks from the above methods is the lack of covariates
accommodation, besides the intensive computation sometimes required.
Kwee et al.
61
proposed a semi-parametric approach that regresses the
quantitative trait on a smooth nonparametric function of the genotype,
allowing adjustment of any covariates. The nonparametric function is
modelled in a reduced-dimension space using kernel function based on
identical-by-state (IBS), thereby reducing the degree of freedom.
where Y
i
denotes the trait for sample i, X
i
the covariate vector, h(g
i
) the
nonparametric function of genotype g
i
, and ε
i
the random sample-specific
Y X h g
i i
T
i i
= + + b e ( )
T
U
U
=
between
within
U
w I g g
k i k j k
j
j n
i
i n
n
between
k
control cases
contr
=

∑ ∑ ∑
=
=
=
=
( )
, ,
(
1 1
ool
cases
n
)
U
w I g g
k i k j k
k i j
n
within
=

∑ ∑
<
( )
( )
, ,
2
173 New Approaches in the Genetics of Myopia
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 173
effect. h and β are estimated using least-square kernel machines. The score
utilizing kernel function is similar to what we have seen:
Considerations for weights are minor-allele frequency (MAF, q) and
p-value of association. The first gives more weights to rare SNPs while the
latter intuitively up weights of SNPs with prior evidence of association.
Several options were suggested: and for rare SNPs, and
for association, which is similar to that used by Wei et al. The test statis-
tics is based on testing the nonparametric function. Simulation results
show the approach achieves higher statistical power compared to single
locus tests.
Non-parametric approaches typically utilize similarity measures prior
to setting up the test statistics. Several methods on genomic similarity in
multi-locus analysis have been discussed in detail by Wessel et al.
59
Various
similarity measures designed with weights to accommodate genomic
functionality, such as IBS, allele frequency, functional variations,
nucleotide conservation, single-locus association, haplotype, and ancestry
were proposed.
Parametric approaches
Multi-locus analysis suffers from large degrees of freedom so one
approach is to reduce the dimensionality by exploiting the underlying
LD structure. Wang and Elston
57
proposed a method using Fourier trans-
formation (FT) to capture the genotype variations across different traits.
In the scenario where SNPs are in LD, the genotypic variation among
trait groups extends across all the SNPs, and hence could be compressed
into low-frequency components of a Fourier transform. To maintain
consistency of genotypic variation across the SNPs, the genotype matrix
is recoded to obtain positive correlation between the SNPs. For an addi-
tive model, this is done by changing the negative correlated SNPs x
ij
by
|2 – x
ij
|.
−log
10
( ) p
k
1
q
k
1
q
k
S g g
w IBS g g
w
i k j k
k i k j k
k
K
k
k
K
( , )
( , )
, ,
, ,
=
=
=


1
1
174 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 174
With the assumption that the genotype affects only the mean of the
phenotype measure and not its scale, the score statistics for the kth FT
component of sample i is
The variance of U
k
is estimated by
To give weights to low frequency FT components, a weight function
[1/(k+1)]
2
is added. The global weighted score statistic is then defined as
which follows an asymptotic normal distribution. V
0
is the estimated
variance-covariance matrix.
Another dimension reduction approach is principal component (PC)
analysis. In Gauderman et al.
55
and Wang and Abbott,
56
PC was computed
for multiple SNPs to capture underlying LD structure and then tested for
association with the disease. Instead of using SNPs in a logistic regression
model, PCs of the sample covariance matrix of SNPs are used. The stronger
the LD among SNPs, the fewer the PCs are needed. Given the property of
PC analysis that variance of the kth PC is its eigenvalue λ
k
, a subset of PCs
that will explain most of the SNP variation is selected, thereby reducing the
degree of freedom. The choice then becomes a trade-off between the
amount of variance explained and the degree of freedom penalty. A general
rule of thumb is to select PCs that explain at least 80% of the variance.
In a similar idea of utilizing LD structure, Li et al.
72
proposed a gene-
based association test by combining optimally weighted markers (ATOM).
It basically assigns weights to markers based on LD structure from a refer-
ence set such as the HapMap. Suppose M markers are available in the
reference set, the score statistic is defined as
s
M p q
g
i k
j
k
j j
i j
j
M
, ,
=
=

1
1

T
w U
w V w
w
T
T
=
0
( ) ( ) ( ) V
n
Y Y x x x x
k i
i
ik k
T
ik k
i
=

− − −
∑ ∑
1
1
2
U Y x x
k i ik k
i
N
= −

( )
175 New Approaches in the Genetics of Myopia
 
 
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 175
where ∆
k
j
is the LD coefficient between markers k and j, and p
j
and q
j
are
allele frequencies of marker j.
To test for genetic association, the authors proposed using the aggregate
score of marker k for all samples in a single marker-based
test or PC of the scores in a regression model. Simulation to compare the
various methods was done using the dataset of CHI3L2 on chromosome 1
and CDH17 on chromosome 8, a benchmark dataset with complemen-
tary gene expression data, where significant evidence was found for
cis-acting regulatory elements.
73
Based on the results, it is difficult to
conclude which method is better. However, it should be noted that
SNPTEST — a method that relies on imputation from IMPUTE
74

shows robust performance.
P-values combining approaches
Methods on p-value combining are a departure from multi-locus analysis,
but still adhere to the methodology from pathway analysis in cancer
genomics. The approach utilizes single marker-based test statistics for a
region of interest (e.g. gene) by selecting the ‘best’ SNP
63,65
or combined p-
values of all SNPs using various methods. P-value combining methods are
quite established, some of which are utilized in meta-analysis. They
include Fisher Information, SIMES, False Discovery Rate, Rank Truncated
Product and its various isoforms, Fourier Transform, and Bayesian
approach.
62,64,66,75,76
Since GWAS test statistics are SNP-based and not gene-
based, the question is the window for determining the gene region in order
to combine the statistics. In Wang et al.,
63
the window is centered at each
SNP with 500kb up- and down-stream of the SNP. Others are based on
genomic intervals elicited from genome databases, some extending the
window into promoter regions. In the simulation study by Chapman
et al.,
62
two separate regions surrounding the genes of interest (24kb for
CTLA4 and 48 kb IL21R) were selected.
Once the GWAS SNP-based statistics is converted into gene-based sta-
tistics, the established approach of gene-set enrichment analysis can be
applied. This involves computing an enrichment score similar to that in
GSEA. Statistical significance and adjustment for multiple testing was
done by permutation. Another approach is to elucidate top ranked SNPs
associated with genes and perform functional analyses using tools such as
DAVID,
77
GoStat,
78
or commercial software Ingenuity Pathway Analysis
s s
k i i k
=
∑ ,
176 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 176
(Ingenuity® Systems, www.ingenuity.com). This approach bypasses the
underlying enrichment effect of combining test statistics within the gene
region and might miss genes that are comprised of SNPs not highly ranked
individually because of small effects, but has an overall combined moder-
ate effect on the disease.
Conclusion
This chapter presents a review of current approaches in utilizing genomic
information in genetics study. Two approaches using genomic conver-
gence and biological pathways are highlighted as complementary methods
to potentially improve power in GWAS. Both methods depend on the type
and relevance of the genomic information elicited for the analyses, requir-
ing collaborative efforts from different expertise to keep afloat in the del-
uge of genomic information. As seen, there is still room to explore the
similarity measures in pathway analysis and how these measures can be
aggregated in a robust manner to allow comprehensive analysis of func-
tionality within a statistical test. At present, each similarity measure is
assessed individually. As we move towards integrative analysis in system
biology, we need to think beyond our current GWAS approaches and
develop methodology that will incorporate genomic information to
enhance discovery. As more biological context is included in the analyses,
the richer and more relevant the information, the better the outcome. In
our study on the genetics of myopia, we have adopted genomic conver-
gence in our GWAS and are currently applying pathway analysis on the
genes in Table 2 to help us identify novel genes.
References
1. Curtin B. (1985) The Myopias: Basic Science and Clinical Management. Harper
& Row, New York.
2. Javitt JC, Chiang YP. (1994) The socioeconomic aspects of laser refractive
surgery. Arch Ophthalmol 112(12): 1526–1530.
3. Vitale S, et al. (2006) Costs of refractive correction of distance vision impair-
ment in the United States, 1999–2002. Ophthalmology 113(12): 2163–2170.
4. Chow YC, et al. (1990) Refractive errors in Singapore medical students.
Singapore Med J. 31(5): 472–473.
177 New Approaches in the Genetics of Myopia
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 177
5. Lin LL, et al. (1988) Nation-wide survey of myopia among schoolchildren in
Taiwan, 1986. Acta Ophthalmol Suppl 185: 29–33.
6. Goss DA, Winkler RL. (1983) Progression of myopia in youth: age of cessation.
Am J Optom Physiol Opt 60(8): 651–658.
7. Saw SM, et al. (1996) Epidemiology of myopia. Epidemiol Rev 18(2): 175–187.
8. Vitale S, et al. (2008) Prevalence of refractive error in the United States,
1999–2004. Arch Ophthalmol 126(8): 1111–1119.
9. Kleinstein RN, et al. (2003) Refractive error and ethnicity in children. Arch
Ophthalmol 121(8): 1141–1147.
10. Zylbermann R, Landau D, Berson D. (1993) The influence of study habits on
myopia in Jewish teenagers. J Pediatr Ophthalmol Strabismus 30(5): 319–322.
11. The Eye Disease Case-Control Study Group. (1993) Risk factors for idiopathic
rhegmatogenous retinal detachment. Am J Epidemiol 137(7): 749–757.
12. Perkins ES. (1960) Glaucoma in the younger age groups. Arch Ophthalmol
64: 882–891.
13. Goss DA, Jackson TW. (1996) Clinical findings before the onset of myopia in
youth: 4. Parental history of myopia. Optom Vis Sci 73(4): 279–282.
14. Zadnik K, et al. (1994) The effect of parental history of myopia on children’s
eye size. JAMA 271(17): 1323–1327.
15. Ashton GC. (1985) Segregation analysis of ocular refraction and myopia.
Hum Hered 35(4): 232–239.
16. Klein AP, et al. (2005) Support for polygenic influences on ocular refractive
error. Invest Ophthalmol Vis Sci 46(2): 442–446.
17. Naiglin L, et al. (1999) Familial high myopia: evidence of an autosomal
dominant mode of inheritance and genetic heterogeneity. Ann Genet 42(3):
140–146.
18. Teikari JM, et al. (1991) Impact of heredity in myopia. Hum Hered 41(3):
151–156.
19. Hammond CJ, et al. (2001) Genes and environment in refractive error: the
twin eye study. Invest Ophthalmol Vis Sci 42(6): 1232–1236.
20. Lyhne N, et al. (2001) The importance of genes and environment for ocular
refraction and its determiners: a population based study among 20–45 year
old twins. Br J Ophthalmol 85(12): 1470–1476.
21. Schwartz M, Haim M, Skarsholm D. (1990) X-linked myopia: Bornholm eye
disease. Linkage to DNA markers on the distal part of Xq. Clin Genet 38(4):
281–286.
22. Chen CY, et al. (2007) Linkage replication of the MYP12 locus in common
myopia. Invest Ophthalmol Vis Sci 48(10): 4433–4439.
23. Farbrother JE, et al. (2004) Linkage analysis of the genetic loci for high
myopia on 18p, 12q, and 17q in 51 U.K. families. Invest Ophthalmol Vis Sci
45(9): 2879–2885.
178 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 178
24. Klein AP, et al. (2007) Confirmation of linkage to ocular refraction on
chromosome 22q and identification of a novel linkage region on 1q. Arch
Ophthalmol 125(1): 80–85.
25. Lam DS, et al. (2003) Familial high myopia linkage to chromosome 18p.
Ophthalmologica 217(2): 115–118.
26. Li YJ, et al. (2009) An international collaborative family-based whole-
genome linkage scan for high-grade myopia. Invest Ophthalmol Vis Sci 50(7):
3116–3127.
27. Nurnberg G, et al. (2008) Refinement of the MYP3 locus on human chromo-
some 12 in a German family with Mendelian autosomal dominant high-grade
myopia by SNP array mapping. Int J Mol Med 21(4): 429–438.
28. Young TL, et al. (2004) X-linked high myopia associated with cone dysfunc-
tion. Arch Ophthalmol 122(6): 897–908.
29. Barrett JC, et al. (2008) Genome-wide association defines more than 30
distinct susceptibility loci for Crohn’s disease. Nat Genet 40(8): 955–962.
30. Amos CI, et al. (2008) Genome-wide association scan of tag SNPs identi-
fies a susceptibility locus for lung cancer at 15q25.1. Nat Genet 40(5):
616–622.
31. Ferreira MA, et al. (2008) Collaborative genome-wide association analysis
supports a role for ANK3 and CACNA1C in bipolar disorder. Nat Genet.
32. Horikawa Y, et al. (2008) Replication of genome-wide association studies
of type 2 diabetes susceptibility in Japan. J Clin Endocrinol Metab 93(8):
3136–3141.
33. Hasumi Y, et al. (2006) Analysis of single nucleotide polymorphisms at
13 loci within the transforming growth factor-induced factor gene shows no
association with high myopia in Japanese subjects. Immunogenetics 58(12):
947–953.
34. Liang CL, et al. (2007) Systematic assessment of the tagging polymorphisms
of the COL1A1 gene for high myopia. J Hum Genet 52(4): 374–377.
35. Metlapally R, et al. (2009) COL1A1 and COL2A1 genes and myopia suscep-
tibility: evidence of association and suggestive linkage to the COL2A1 locus.
Invest Ophthalmol Vis Sci 50(9): 4080–4086.
36. Paluru PC, et al. (2004) Exclusion of lumican and fibromodulin as candidate
genes in MYP3 linked high grade myopia. Mol Vis 10: 917–922.
37. Mutti DO, et al. (2007) Candidate gene and locus analysis of myopia. Mol Vis
13: 1012–1019.
38. Scavello GS Jr, et al. (2005) Genomic structure and organization of the
high grade Myopia-2 locus (MYP2) critical region: mutation screening of 9
positional candidate genes. Mol Vis 11: 97–110.
39. Simpson CL, et al. (2007) The roles of PAX6 and SOX2 in myopia: lessons
from the 1958 British Birth Cohort. Invest Ophthalmol Vis Sci 48(10):
4421–4425.
179 New Approaches in the Genetics of Myopia
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 179
40. Zayats T, et al. (2008) Comment on ‘A PAX6 gene polymorphism is associated
with genetic predisposition to extreme myopia’. Eye 22(4): 598–599; author
reply 599.
41. Hauser MA, et al. (2003) Genomic convergence: identifying candidate genes
for Parkinson’s disease by combining serial analysis of gene expression and
genetic linkage. Hum Mol Genet 12(6): 671–677.
42. Noureddine MA, et al. (2005) Genomic convergence to identify candidate
genes for Parkinson disease: SAGE analysis of the substantia nigra. Mov
Disord 20(10): 1299–1309.
43. Bowes Rickman C, et al. (2006) Defining the human macula transcriptome
and candidate retinal disease genes using EyeSAGE. Invest Ophthalmol Vis Sci
47(6): 2305–2316.
44. Mootha VK, et al. (2003) PGC-1alpha-responsive genes involved in oxidative
phosphorylation are coordinately downregulated in human diabetes. Nat
Genet 34(3): 267–273.
45. Edelman E, et al. (2006) Analysis of sample set enrichment scores: assaying
the enrichment of sets of genes for individual samples in genome-wide
expression profiles. Bioinformatics 22(14): p. e108–e116.
46. Tian L, et al. (2005) Discovering statistically significant pathways in expression
profiling studies. Proc Natl Acad Sci USA 102(38): 13544–13549.
47. Kim SY, Volsky DJ. (2005) PAGE: parametric analysis of gene set enrichment.
BMC Bioinformatics 6: 144.
48. Subramanian A, et al. (2005) Gene set enrichment analysis: a knowledge-
based approach for interpreting genome-wide expression profiles. Proc Natl
Acad Sci USA 102(43): 15545–15550.
49. Barry WT, Nobel AB, Wright FA. (2005) Significance analysis of functional
categories in gene expression studies: a structured permutation approach.
Bioinformatics 21(9): 1943–1949.
50. Tomfohr J, Lu J, Kepler TB. (2005) Pathway level analysis of gene expression
using singular value decomposition. BMC Bioinformatics 6: 225.
51. Slager SL, Huang J, Vieland VJ. (2000) Effect of allelic heterogeneity on
the power of the transmission disequilibrium test. Genet Epidemiol 18(2):
143–156.
52. Sweet-Cordero A, et al. (2005) An oncogenic KRAS2 expression signature
identified by cross-species gene-expression analysis. Nat Genet 37(1):
48–55.
53. Alvarez JV, et al. (2005) Identification of a genetic signature of activated sig-
nal transducer and activator of transcription 3 in human tumors. Cancer Res
65(12): 5054–5062.
54. Bild AH, et al. (2006) Oncogenic pathway signatures in human cancers as a
guide to targeted therapies. Nature 439(7074): 353–357.
180 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 180
55. Gauderman WJ, et al. (2007) Testing association between disease and multiple
SNPs in a candidate gene. Genet Epidemiol 31(5): 383–395.
56. Wang K, Abbott D. (2008) A principal components regression approach to
multilocus genetic association studies. Genet Epidemiol 32(2): 108–118.
57. Wang T, Elston RC. (2007) Improved power by use of a weighted score test
for linkage disequilibrium mapping. Am J Hum Genet 80(2): 353–360.
58. Schaid DJ, et al. (2005) Nonparametric tests of association of multiple genes
with human disease. Am J Hum Genet 76(5): 780–793.
59. Wessel J, Schork NJ. (2006) Generalized genomic distance-based regression
methodology for multilocus association analysis. Am J Hum Genet 79(5):
792–806.
60. Wei Z, et al. (2008) U-Statistics-based tests for multiple genes in Genetic
Association Studies. Ann Hum Genet.
61. Kwee LC, et al. (2008) A powerful and flexible multilocus association test
for quantitative traits. Am J Hum Genet 82(2): 386–397.
62. Chapman J, Whittaker J. (2008) Analysis of multiple SNPs in a candidate gene
or region. Genet Epidemiol 32(6): 560–566.
63. Wang K, Li M, Bucan M. (2007) Pathway-Based Approaches for Analysis of
Genomewide Association Studies. Am J Hum Genet 81(6).
64. Zhou H, Wei LJ, Xu X. (2008) Combining association tests across multiple
genetic markers in case-control studies. Hum Hered 65(3): 166–174.
65. Torkamani A, Topol EJ, Schork NJ. (2008) Pathway analysis of seven common
diseases assessed by genome-wide association. Genomics 92(5): 265–272.
66. Yu K, et al. (2009) Pathway analysis by adaptive combination of P-values.
Genet Epidemiol 33(8): 700–709.
67. Dinu V, Miller PL, Zhao H. (2007) Evidence for association between
multiple complement pathway genes and AMD. Genet Epidemiol 31(3):
224–237.
68. Pan W. (2008) Network-based model weighting to detect multiple loci influ-
encing complex diseases. Hum Genet 124(3): 225–234.
69. Clayton D, Chapman J, Cooper J. (2004) Use of unphased multilocus
genotype data in indirect association studies. Genet Epidemiol 27(4): 415–428.
70. Salem RM, Wessel J, Schork NJ. (2005) A comprehensive literature review of
haplotyping software and methods for use with unrelated individuals. Hum
Genomics 2(1): 39–66.
71. Hoeffding W. (1948) A class of statistics with asymptotically normal distribu-
tion. Annals of Mathematical Statistics 22: 165–179.
72. Li M, et al. (2009) ATOM: a powerful gene-based association test by com-
bining optimally weighted markers. Bioinformatics 25(4): 497–503.
73. Cheung VG, et al. (2005) Mapping determinants of human gene expression
by regional and genome-wide association. Nature 437(7063): 1365–1369.
181 New Approaches in the Genetics of Myopia
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 181
74. Marchini J, et al. (2007) A new multipoint method for genome-wide associa-
tion studies by imputation of genotypes. Nat Genet 39(7): 906–913.
75. Zaykin DV, et al. (2002) Testing association of statistically inferred haplotypes
with discrete and continuous traits in samples of unrelated individuals. Hum
Hered 53(2): 79–91.
76. Peng G, et al. (2009) Gene and pathway-based second-wave analysis of
genome-wide association studies. Eur J Hum Genet.
77. Huang da W, et al. (2007) DAVID Bioinformatics Resources: expanded anno-
tation database and novel algorithms to better extract biology from large gene
lists. Nucleic Acids Res. 35(Web Server issue): W169–W175.
78. Beissbarth T, Speed TP. (2004) GOstat: find statistically overrepresented
Gene Ontologies within a group of genes. Bioinformatics 20(9): 1464–1465.
182 L.K. Goh, R. Metlapally and T. Young
b846_Chapter-3.1.qxd 4/8/2010 1:58 AM Page 182
Twins Studies and Myopia
Maria Schäche*
,†
and Paul N. Baird

Twins provide a unique resource with which to study the influence of
genetic and environmental factors on the development of myopia. In this
chapter we review some of the methodological approaches that have been
used in twin cohorts to quantitate the extent of involvement of genes in
myopia and its underlying determinants such as axial length, anterior
chamber depth, and corneal curvature. The use of twins to study the asso-
ciation of myopia with other factors such as birth weight, body stature, and
personality will also be discussed.
Introduction
Myopia is defined as a complex trait as its underlying causes are both
genetic and environmental in origin. Environmental factors such as exces-
sive reading, high educational attainment, and urbanization
1–3
have been
suggested as risk factors in its etiology, but more recently, studies by Rose
et al. (2008) and Dirani et al. (2009) have suggested that increased expo-
sure to outdoor activity may be protective for myopia, but their results
remain under debate.
3,4
The known environmental factors account for
approximately 11.6% of the phenotypic variation seen with myopia,
which suggests that there are other, as yet, unidentified factors that also
play a major role in its development.
Evidence supporting a genetic origin for myopia has come from several
sources including familial correlation studies, association studies, and
genetic linkage studies. Data suggests that children of myopic parents are
183
3.2
*Corresponding author. E-mail: [email protected]

Centre for Eye Research Australia, University of Melbourne, Royal Victoria Eye and Ear Hospital,
32 Gisborne Street, East Melbourne, Victoria 3002, Australia.
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 183
at four times greater risk of developing myopia than children with no
myopic parents.
5,6
In support of this, genetic linkage studies in large
multigenerational families have suggested over 27 loci are involved in
the development of myopia.
7
In this chapter, the discussion will focus pre-
dominately on twin studies and touch very briefly on family studies only
for comparative purposes.
A complete understanding of the underlying causes of myopia requires
a survey of both the environmental and genetic influences on the condi-
tion. This chapter will describe the application of twin studies in measur-
ing the genetic and environmental components of myopia. A description
of the most commonly used methodologies will be provided, including the
advantages and limitations of each. This chapter is not intended to be a
comprehensive review of all the methodological approaches using twins in
genetic studies, but will instead focus on those that have been used to
study myopia.
This chapter begins with some important definitions and a historical
perspective on how the use of twins in genetic studies of myopia origi-
nated. Only articles written in English or those with English translations
have been reviewed.
Definition of Myopia
Any genetic study into myopia, or other conditions, must begin with a
clear definition of the phenotype (physical presentation). The simplest
approach is to define myopia as a type of refractive error that affects visual
acuity. In the case of myopia, parallel light rays entering the eye are
focussed in front of the retina, resulting in blurred distance vision. Myopia
is clinically defined using Spherical Equivalent (SE) measures that are
quantitated using units of dioptres (D). Typically, individuals having
dioptre readings of −0.5 D or less in one or both eyes are considered to be
myopic with further classifications into low (–0.5 D to –2.99 D), moderate
(–3.00 D to –5.99 D) and high myopia (<–6.0 D). Whilst these categorical
definitions are commonly used and accepted, there is some debate as to the
validity of using relatively arbitrary clinical cut-offs. An alternative way
to define myopia is to broaden the definition and consider the entire spec-
trum of refraction measures, from hypermetropia (positive refractive
values) to emmetropia and myopia (negative refractive values). This
approach considers refraction as a quantitative trait that can influence
184 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 184
myopia as well as other refractive errors. Both categorical and quantitative
definitions have been used with success in myopia genetic studies.
In addition to these issues, it is also important to appreciate that the
refractive status of the eye has a number of underlying determinants that
may be considered as sub-phenotypes. In particular, the refractive status of
the eye is largely determined by the coordinated contributions of three
principle ocular biometric components: ocular axial length, anterior
chamber depth, and corneal curvature. A mismatch between the length
of the eye and the combined refractive power of the lens and cornea leads
to intercepting light rays falling short of the retina, thus leading to blurred
vision.
7
The sub-phenotype of axial length, independent of a person’s
overall height, is a major trait as it has been reported to explain at least half
of the total variance of myopia.
8
Therefore, it is important to consider the
complexity of the phenotypic definition of myopia when undertaking
genetic studies. As will be detailed below, there has been a recent shift in
studies for myopia that takes these sub-phenotypes into account. With
these definitions in mind, we now turn our attention to twins and their
application to the study of the genetics of myopia.
The Classical Twin Model
What is the classical twin model?
A twin can be defined as one of two offspring produced in the same preg-
nancy and born during the same birthing procedure. There are two main
classes of twins — monozygotic and dizygotic. Monozygotic twins (also
known as identical twins) develop when a single ovum (egg) is fertilized
and splits into two independent embryos early during development.
Monozygotic twins share one hundred per cent of their genetic material,
unless there is a de novo mutation during early development. They are very
similar in their physical appearance but not always completely identical
due to the influence of environmental factors.
On the other hand, dizygotic twins (also known as non-identical,
biovular, or fraternal twins) develop when two independent ova (eggs)
are fertilized at the same time. Dizygotic twins share 50% of their genetic
material and from a genetic point of view can be considered as siblings
born at the same time. Dizygotic twins can be of the same sex or opposite
sexes whereas monozygotic twins are always of the same sex. Dizygotic
185 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 185
twins are more common than monozygotic twins, accounting for 0.8% of
live births in Caucasian populations compared to 0.4% for monozygotic
twins. Monozygotic twinning rates are relatively constant in different pop-
ulation, whereas dizygotic twinning rates vary with ethnicity, ranging from
0.4% of live births in populations of Asian descent to as high as 4.5% in
Africans.
The proportion of genetic material that is shared between monozygotic
twins and dizygotic twins can be exploited by genetic studies to allow an
assessment of the relative importance of genes and environment in the devel-
opment of myopia. As monozygotic twins share all their genetic material, this
suggests that differences in the clinical expression of myopia between
monozygotic twins are likely to be due to non-genetic effects. On the other
hand, for dizygotic twins that share up to 50% of their genetic material,
the differences in clinical expression will be due to both genetic and environ-
mental effects. In other words, if a trait is influenced by genetic factors then
one would expect that monozygotic twins would be phenotypically very sim-
ilar (concordant), and that dizygotic twins would be less so. This principle is
the fundamental basis of the “classical twin model” that is used to determine
whether myopia is influenced by hereditary factors or non-hereditary
(environmental) factors, and to what extent.
Historical perspective
The use of twins as a means to understand the aetiology of myopia and
refractive errors originated in 1924 when Walter Jablonski published an
article in a German journal that translates to English as, “A contribution to
the hereditary refraction in human eyes.”
9
This study has been buried in
the literature for some time with its existence coming to the forefront by
the recent publication by Liew that summarizes the original Jablonski
publication.
10
The Jablonski paper was pioneering for its time in that it was
not only the first publication to use the “classical twin model” to analyze
refraction, but it was also the first to have applied it to any trait.
The Jablonski study consisted of 40 pairs of monozygotic twins and
12 pairs of dizygotic twins, all of which underwent ophthalmic examina-
tions. Refraction measurements were compared within each pair of twins
(within-pair differences) and a comparison was made between within-pair
differences for monozygotic twins compared to dizygotic twins. It was
reported that the within-pair differences were less in monozygotic twin
pairs than in dizygotic twin pairs. Thus, the monozygotic twins were more
186 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 186
concordant for measures of refraction compared to dizygotic twins. These
results provided the first clue that there may be an underlying hereditary
influence to refraction. In fact, this study was well ahead of its time as it
was not until much later that additional quantitative studies of this nature
were undertaken.
Following the Jablonski study, a series of reports were published that
supported the notion that refraction was most likely influenced by genetic
factors. Here, we highlight two of them.
The first report was published in 1935 by Law and examined eight pairs
of what are presumed to be monozygotic twin pairs.
11
Refraction meas-
urements were compared between monozygotic twins and their respective
siblings born at different times. It was observed that refraction measure-
ments were similar twice as often in monozygotic twins than they were in
the siblings.
Another report, published in 1948 by Burns, observed a single pair of
monozygotic twin pairs with similar levels of myopia.
12
This study went on
to examine the extended pedigree of these twins and observed a presumed
transmission pattern for myopia through the generation of the family of
these twins. These observations were taken together to conclude that the
influences on myopia are genetic in origin.
Early studies such as the ones described above were largely observa-
tional in nature and certainly crude when measured against current
methodological approaches. However, the fundamental observations are
valid and they provided the first hint of evidence to suggest that refraction
and myopia are influenced by genetic factors.
Statistical approaches
In 1962, Sorsby et al. published a study using the classical twin model
to analyze refraction.
13
The typical approach was taken whereby within-
pair refraction measures were compared between monozygotic
twin pairs, dizygotic twin pairs, and control pairs. As predicted from
previous studies, Sorsby et al. observed a consistently smaller within-pair
difference in monozygotic twins compared to dizygotic twins. This
finding was not novel or unexpected, but in 1964 this work was extended
by additional work from Sorsby and Fraser to include statistical
measures.
14
This statistical analysis from Sorsby and Fraser involved using correla-
tion coefficients (a measure of the extent to which measures between a
187 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 187
twin and their co-twin vary) to quantitate the within-pair differences
between twin pairs. Correlation coefficients were calculated for monozy-
gotic twins, dizygotic twins, and unrelated age and gender matched con-
trols pairs. Correlation coefficients were calculated for refraction, corneal
power, lens power, axial length, and anterior chamber depth, and were in
all cases found to be higher in the monozygotic twin pairs. This study was
important as it raised the study of twins and myopia to a new level with
the introduction of statistical measures to complement previous observa-
tional studies for the classical twin model.
The statistical measures suggested by Sorsby et al. in 1962 have since
been extended and refined into what is now known as the heritability
study. Heritability studies aim to provide an absolute quantitation of the
extent to which genetic and environmental factors contribute to myopia.
Heritability (h2) is broadly defined as the proportion of phenotypic vari-
ance attributed to genetic factors. In very simple terms, heritability can be
estimated by multiplying the difference between monozygotic and dizy-
gotic twin pair within-pair correlations by a factor of two. Heritability
measures range from 1.0 for a trait that is entirely influenced by genes to
0 for a trait that is influenced entirely by environmental factors. The
beauty of this type of analysis is that it can be extended to quantify the
proportion of phenotypic variance that is due to environmental factors
such as unique environment effects (those that affect one twin but not the
co-twin) and common environment effects (those that affect both twins).
In real terms, the calculation of heritability and the contributions of
shared and common environmental effects are more sophisticated than
this. Analyzes are able to model the genetic effects to determine if there are
multiple contributing genes each with small effects (additive model) or if
there is one major gene (dominant model). Additionally, other factors that
may affect refraction measures such as age, gender, and height can also be
taken into account.
The true elegance of heritability studies come from the fact that one can
determine the role of hereditary in myopia without any prior knowledge
of the exact nature of the contributing genes. Similarly, the role of envi-
ronmental factors can also be assessed without knowing their exact nature.
Hence, twins provide a unique opportunity to study gene-environment
effects and are often referred to as the “perfect natural experiment.”
15
Next,
we describe a selection of published heritability studies that have used
twins to study myopia.
188 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 188
Twins, Myopia and Heritability Studies
Heritability studies for myopia using twins
Heritability studies ultimately aim to quantify the proportion of pheno-
typic variance that is due to genetic effects. In the case of myopia, heri-
tability studies using twins as the model have defined myopia in terms of
the quantitative measure of refraction. Heritability estimates for myopia
have ranged from 0.77 in a cohort of British twins to 0.91 for a cohort of
Danish twins.
16–18
For the British twins, the heritability study was extended
in a genetic linkage study whereby analysis was undertaken in order
to determine where the gene or genes contributing to myopia are located
in the human genome. This linkage analysis identified four regions in
the genome on chromosomes 11p13, 3q26, 8p23, and 4q12 that may
contain myopia genes.
19
These results have been partly confirmed in two
independent studies. The first by the same group confirmed linkage to the
chromosome 3q26 region as harboring a myopia gene.
20
The second study
by Stambolian et al. (2005) in a family-based cohort independently con-
firmed the locus on chromosome 8p23.
21
However, our own study using
an Australian twin cohort did not find evidence to suggest that any of
these chromosomal regions were linked to myopia.
22
Further analysis is
clearly warranted in order to identify the precise genetic change in these
regions.
A heritability study in a cohort of Australian twins suggested there may
be a gender effect with heritability estimates of 0.88 reported for male
twins and 0.75 for females.
23
However, the true extent of this gender effect
in other cohorts remains to be further investigated. Furthermore, these
heritability studies have also suggested that the environmental component
to myopia is due predominately to unique environment effects rather than
environmental factors that are shared between a twin and its co-twin.
From these heritability estimates it is clear that the major influence on
refraction, and hence on myopia, is likely to come from genes.
Furthermore, heritability studies have suggested that the gene effects on
myopia are likely to be additive, meaning that these are the result of mul-
tiple genes, each with small effects that come together to cause myopia.
17,23
In conjunction with this, a myopia heritability study by Dirani et al. (2006)
in an Australian twin cohort suggested that the genetic effects are even
more complex in that there are not only additive genetic effects, but also
dominant effects whereby there is one predominant gene that causes
189 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 189
myopia.
23
In other words, there are likely to be multiple genes with varied
and complex gene-gene interactions that are contributing to the develop-
ment of myopia.
Although there is a significant amount of evidence from twin studies to
suggest that myopia is predominately a genetic trait, not all studies are in
agreement. A study by Angi et al. (1993) in an Italian twin cohort sug-
gested that the genetic contribution to refraction was between 8–14%,
indicating that the majority of the phenotype is not influenced by genetic
effects.
24
This appears to be the only heritability study in twins to argue
against the involvement of genes in the development of myopia. It is of
course possible that this result is true and there is something curiously dif-
ferent about this population in Italy, although this is unlikely to be the case
as other studies have been performed on twin cohorts of similar ethnicity.
The study by Angi et al. (1993) used a small sample of twins comprising of
29 pairs in total, which differs from the other heritability studies that used
between 114 and 2301 twin pairs. Additionally, the Angi study utilized
twins that were under the age of 7 years, in which refraction measurements
may not yet have stabilized. Other studies have predominately used adult
twins, which have more stable and reliable refraction measures provided
that age-related changes in refraction (presbyopia) are accounted for. The
small sample size and limited age ranges makes the Angi study results
likely to be flawed, and until there is another study replicating this finding
it must be treated with caution.
As we have discussed earlier in this chapter (see section “definitions”),
the phenotypic definition of myopia is complicated and extends beyond
simple refraction measures. It is influenced by the sub-phenotypes of
ocular axial length, anterior chamber depth, and corneal curvature.
With these sub-phenotypes in mind, heritability studies for myopia have
been extended to ask the question of what is the genetic influence on axial
length, corneal curvature, and anterior chamber depth. We will highlight
three key twin studies that have undertaken a heritability analysis on
these traits.
The first study by Lyhne et al. (2001) from Denmark analyzed 53
monozygotic and 61 dizygotic twin pairs using the classical twin model.
17
This study reported heritability estimates of 0.94, 0.88–0.94, and 0.90–0.92
for axial length, anterior chamber depth, and corneal curvature respec-
tively. Furthermore, axial length and corneal curvature measurements
could largely be explained by additive genetic effects, whereas anterior
chamber depth was explained mainly by dominant effects.
190 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 190
The next study by Dirani et al. (2006) from Australia supported
the results from Lyhne et al. (2001) in that it showed that these traits
were predominately genetic in origin but there were some differences in
the findings.
23
For example, Dirani et al. (2006) suggested that axial
length was influenced by dominant genetic effects rather than additive
effects. Additionally, corneal curvature in the Dirani et al. (2006) study
was also suggested as being influenced by dominant genetic effects as
opposed to additive effects reported for the Lyhne et al. (2001) study. It
is unclear why such a difference existed in the results for axial length, but
those for corneal curvature could mostly be explained by discrepancies
in the measures used. The Lyhne et al. (2001) study obtained keratome-
try measures using an autokeratometer and then averaged the values
from the two principal meridians to get the final corneal curvature out-
put. On the other hand, the Dirani et al. (2006) study calculated the dif-
ference between the two keratometry readings as the final corneal
curvature output.
The third study by Zhu et al. (2008) focussed on axial length and added
further support for a genetic involvement in this trait.
25
This study used
131 monozygotic and 302 dizygotic twin pairs and reported a heritability
of 0.81 for axial length, which was largely determined by additive genetic
effects. This study went further in the analysis and performed a genetic
linkage analysis in order to determine where the gene or genes contribut-
ing to axial length are located in the human genome. This work suggested
that a region on human chromosome 5q spanning 98 cM is likely to con-
tain a gene for axial length. Additionally, a number of other genomic
regions on chromosomes 6, 10, and 14 also indicated the likely existence of
other genes that might influence axial length. Replication studies are
required to establish the consistency of these regions as well as further
characterization of the identified genomic regions in order to establish the
exact nature of the causative genes.
Further extension of the basic heritability analysis also needs to be
undertaken in order to determine if there are common genes between
myopia and its underlying determinants. To date, two such studies have
been undertaken, which performed a statistical analysis to determine the
extent to which genetic and environmental effects influencing axial length
also influence refraction or anterior chamber depth.
8,26
These studies were
undertaken by fitting a bivariate Cholesky decomposition model to axial
length and refraction or axial length and anterior chamber depth within
the heritability analysis. For a more detailed description on this statistical
191 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 191
methodology, we refer the reader to Loehlin et al.
27
The first study by
Dirani et al. (2008) suggested that not only were refraction and axial length
highly heritable traits, but also that 50% of the genes influencing refrac-
tion are common to axial length. The second study by He et al. (2008) went
on to suggest that 25% of the genes influencing axial length are also com-
mon to anterior chamber depth, suggesting that there are shared genetic
influences on myopia and its determinants.
Although we have endeavored to convince the reader of the utility of
using twins in heritability studies for myopia, a word of caution is
required at this point. As we have hinted at earlier, the results from her-
itability studies may not necessarily always be reliable. Results need to be
interpreted with scientific rigor and some scepticism. General flaws that
are evident in the myopia twin literature are in the methodologies used
in various studies. Some studies used less reliable measures of refraction,
such as questionnaires or current eyeglass prescriptions. Given the high
number of under- or un-corrected myopic individuals in the commu-
nity, this measure can in some cases provide an unreliable estimate of
true refraction measures.
28
Additionally, it is known that age (>50 years)
as well as gender can affect refraction measures, so these also need to be
taken into account. Caution should also be taken with studies that have
small sample sizes, as highlighted above, or those with selection biases,
as this may skew statistical calculations. Additionally, using cohorts of
older twins poses problems as the effects of age-related hyperopic shift
can skew true refraction measures. Having said all this, it should be
noted that many of the myopia heritability studies have provided robust
and reliable heritability estimates for a number of traits. These have con-
vincingly demonstrated there is a clear and strong genetic involvement
in myopia and its underlying sub-phenotypes, such as axial length.
Limitations of using twins in heritability studies
Heritability studies and the underlying principle of the classical twin
model have proven to be a valuable tool for the study of myopia and its
determinants. These tools can also be used to study other traits to quanti-
tate the level of involvement of genes and environment in their etiology,
but discussion of these studies are beyond the scope of this chapter.
Heritability studies for myopia have also been undertaken using extended
families rather than twins, which may provide some advantages given that
192 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 192
the classical twin model relies on a number of assumptions that may skew
heritability calculations.
One of the major assumptions of the classical twin model is the “equal
environment assumption” (EEA). The EEA assumes that monozygotic
twins and dizygotic twins are exposed to the same degree of environmen-
tal factors. Environmental factors can be considered to be anything that is
non-genetic in origin that can influence the development of myopia. If the
EEA is true, then any phenotypic differences between monozygotic and
dizygotic twin will likely be due to genetic effects. However, it has been
argued that monozygotic twins have a greater sharing of environment
during their upbringing as they tend to be treated more alike than dizy-
gotic twins.
29
If this argument holds (and hence the EEA does not), then
one would expect that monozygotic twins will exhibit a greater phenotypic
similarly due to greater shared environment rather than due to shared
genes. A natural test for the EEA is to observe twins that have mislabeled
zygosities, or in other words, monozygotic twins that were thought to be
dizygotic by their parents or vice versa. However, the number of misla-
beled twins is small, and hence, there is limited data available to test the
validity of the EEA with respect to myopia.
The classical twin model also makes the assumption that genetic and
environmental effects on the trait, myopia in this case, are independent.
The model does not account for the possibility of gene-environment inter-
actions (see Chapter 1.3 for further detail). It has been suggested that there
is likely to be an interplay between genes and the environment, such that
genetically susceptible individuals may develop myopia if they are exposed
to environmental risk factors such as excessive near work.
17
The classical
twin model does not account for the potential effect that environmental
factors may have on the phenotypic expression of myopia during a per-
son’s lifetime.
These fundamental assumptions of the classical twin model described
above generally result in an overestimation of the genetic influences on
myopia. This is exemplified by the fact that myopia studies using family
designs have calculated lower heritability values of 0.5 and 0.61 for refrac-
tion compared to twin based studies.
30,31
More recent advances in statisti-
cal methodologies for twin analysis have meant that these limitations
have less of an impact on the heritability estimates, but nevertheless
heritability estimates from twin studies should generally be considered
as the upper limit.
193 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 193
Twins and Myopia — Other Studies
Studies using twins have proved invaluable in determining that genes play
a role in the development of myopia, but they have also indicated that
environmental factors also play a role, albeit to a lesser extent. There have
been many studies assessing the role of environmental factors in the
development of myopia, as has been described in detail in Chapter 1.3.
Here, we will focus on the handful of studies that have been performed in
twins. In particular, the role of body stature, birth weight, educational
attainment, and personality will be discussed.
The possibility that intrauterine factors may influence the development
of myopia has been explored in a number of studies. A study by Grijbovski
et al. (2005) assessed the role of birth weight in the development of mul-
tiple traits, including myopia.
32
Using a cohort of 2880 monozygotic twins
and 4960 dizygotic twins recruited from Norway, Grijbovski et al. (2005)
were able to show that birth weight is negatively associated with myopia.
In other words, a lower birth weight increases the risk of developing
myopia. This opened up the possibility that intrauterine factors that influ-
ence birth weight may also impact of the development of myopia later in
life. However, this finding was not replicated in a more recent study by
Dirani et al. (2009), which suggested there was no statistically significant
association between birth weight and myopia.
33
Clearly, the potential role
of intrauterine factors in myopia remains unclear.
Work has also focussed on physical attributes in adult twins that may
influence myopia. This has been undertaken in studies that have tried to
define a particular body type (height, weight, body mass index) that may
predispose a person to myopia. A study by Teikari et al. (1987) using both
twins and singletons suggested that height and body mass index, but not
weight, are positively associated with myopia, and that this association is
only evident in males.
34
In contrast to this, a recent study by Dirani et al.
(2009) suggested that height and body mass index are not associated with
myopia, but that increased weight is a risk factor for myopia in females.
35
The conflicting evidence from these studies suggests that there is unlikely
to be a “myopia body type.”
In addition to these attempts to find a “myopia body type,” many stud-
ies have also attempted to define behavioral characteristics that may pre-
dispose a person to the development of myopia. It has long been believed
that myopic individuals have a tendency to certain personality traits such
as introversion and conscientiousness. However, an important study by
194 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 194
van de Berg et al. (2008) suggested that this was certainly not the case, with
no association found between myopia and these personality traits. What
van de Berg et al. (2008) did find was that myopia was associated with a
group of traits referred to as “openness.” “Openness” refers to a group of
interrelated personality traits, including the desire to try new things, a
tendency towards a vivid imagination, the readiness to re-examine tradi-
tional values, and the tendency to be intellectually curious. These results
suggested that perhaps there may be an association between education lev-
els and myopia. This association has been confirmed in studies by Lyhne
et al. (2001) and Dirani et al. (2008), showing that myopia is associated
with increased levels of education.
17,36
Furthermore, it has been suggested
that educational attainment is also a highly heritable trait (heritability
measure of 0.66) and that there is a commonality between the genes
related to educational attainment and myopia.
36
Thus, both environmen-
tal as well as genetic components need to be considered when undertaking
studies involving traits such as myopia.
The Importance of Twin Registries
While our focus in this chapter is exclusively on twins and myopia it
should be made clear to the reader that twins can be used to study a myr-
iad of traits limited only by the individual investigator’s research interests.
To facilitate scientific studies using twins, a number of twin registries have
been established around the world. These registries are a national or some-
times regional register of twins and their families that are willing to par-
ticipate in scientific studies. A number of such twin registries have been
used for the study of myopia, including the Australian Twin Registry
(ATR), the Danish Twin Registry (DTR), and the St. Thomas’ UK Adult
Twin Registry. These registries have been invaluable in being able to recruit
twins for such studies as outlined in this chapter. We will now briefly
describe these registries and the myopia studies that they have facilitated.
The most utilized twin registry for the study of myopia is by far the
ATR. The ATR was established in the 1970’s and is a registry of twins liv-
ing in Australia.
37
The ATR is volunteer based and there is no selection bias
in terms of zygosities, ages, or medical history. In essence, any twins born
and residing in Australian who are willing to participate in scientific stud-
ies are included in the ATR. In total there are over 31,000 twin pairs regis-
tered with the ATR, of which 38% are monozygotic, 58% are dizygotic, and
195 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 195
4% are of unknown zygosities. The ATR has facilitated many major
myopia studies including the Genes in Myopia (GEM) Study, which
recruited twins from the state of Victoria and the Twins Eye Study in
Tasmania, which recruited twins from the state of Tasmania.
25,38
A third
study, the Brisbane Adolescent Twin Study, also used the ATR as a recruit-
ment source in addition to independent recruitment regionally in the state
of Queensland.
39
Other twin registries that have proven invaluable in the study of myopia
have been the Danish Twin Registry and the St Thomas’ UK Adult Twin
Registry.
40,41
The Danish Twin Registry is the oldest twin registry in the
world, having been established in 1954, and contains at least 75,000 twin
pairs. The St Thomas’ UK Adult Twin Registry was established in 1993 and
contains at least 10,000 twin pairs. Both these registries have been valuable
sources for recruitment of twins for many myopia studies, including heri-
tability studies from Lyhne et al. (2001), Hammond et al. (2001), and
Lopes et al. (2009), which we have previously described.
16–18
Concluding Comments
In this chapter we have summarized the current methodological
approaches that have been used to study twins and myopia. This is by no
means a comprehensive description of all experimental designs incorpo-
rating twins in the study of heritable traits, but it is a focussed discussion
on the methods used with respect to myopia. It is clear that twins can pro-
vide a valuable insight into the relative contributions of genes and envi-
ronment to the development of myopia and its underlying determinants.
Despite the methodological limitations, particularly with regards to the
classical twin model, current twin studies indicate that myopia is likely to
be a highly heritable trait as are its underlying determinants such as axial
length.
The next step in the use of twins to understand the etiology of myopia
will be to undertake more detailed genetic studies to pinpoint the exact
nature of the hereditary factors influencing myopia. This can now be
achieved through the use of gene chip technology, which allows up to
one million single nucleotide polymorphisms (SNPs) across the entire
genome to be assessed in a single association study. Such studies, termed
genome-wide association studies (GWAS), can be used to identify gene
variants that are associated with myopia. GWAS analysis is statistically
196 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 196
demanding and findings will require verification in order to confirm their
role in myopia (see Chapter 3.4). Furthermore, gene-environment inter-
action studies will also be required to understand how identified genetic
variants interact with environmental factors. However, these issues are
beyond the scope of this chapter, but will be covered in Chapter 1.2.
The current chapter has highlighted the power and utility of twins in
the study of myopia and indicated that myopia is a complex trait with a
polygenic etiology. Twins have therefore provided an extremely useful
resource with which we have been able to gain valuable information
regarding myopia and it is envisaged that their continued use will allow us
to uncover many more facets of myopia in the future.
Acknowledgments
The author’s research on myopia is supported by the Australian Federal
Government through a National Health and Medical Research Project
Grant (#529912), as well by the Angior Family Foundation.
References
1. Saw SM, Chua WH, Hong CY, et al. (2002) Nearwork in early-onset myopia.
Invest Ophthalmol Vis Sci 43: 332–339.
2. Morgan I, Rose K. (2005) How genetic is school myopia? Prog Retin Eye Res
24: 1–38.
3. Rose KA, Morgan IG, Smith W, et al. (2008) Myopia, lifestyle, and schooling
in students of Chinese ethnicity in Singapore and Sydney. Arch Ophthalmol
126: 527–530.
4. Dirani M, Tong L, Gazzard G, et al. (2009) Outdoor activity and myopia in
Singapore teenage children. Br J Ophthalmol 11: 11.
5. Liang CL, Yen E, Liu C, et al. (2004) Impact of family history of high myopia
on level and onset of myopia. Invest Ophthalmol Vis Sci 45: 3446–3452.
6. Wallman J. (1994) Parental history and myopia — Taking the long view.
JAMA 272: 1255–1256.
7. Young TL, Metlapally R, Shay AE. (2007) Complex trait genetics of refractive
error. Arch Ophthalmol 125: 38–48.
8. Dirani M, Shekar SN, Baird PN. (2008) Evidence of shared genes in refraction
and axial length: the Genes in Myopia (GEM) twin study. Invest Ophthalmol
Vis Sci 49: 4336–4339.
197 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 197
9. Jablonski W. (1922) Ein Beitrag zur Vererbung der Refraktion menschlicher
Augen [A contribution to the hereditary of refraction in human eyes]. Arch
Augenheilk 91: 308–328.
10. Liew SH, Elsner H, Spector TD, Hammond CJ. (2005) The first “classical”
twin study? Analysis of refractive error using monozygotic and dizygotic
twins published in 1922. Twin Res Hum Genet 8: 198–200.
11. Law FW. (1935) The Refractive Error of Twins. Br J Ophthalmol 19: 99–101.
12. Burns RA. (1949) Hereditary myopia in identical twins. Br J Ophthalmol 33:
491–494.
13. Sorsby A, Sheridan M, Leary GA. (1962) Refraction and its components in
twins. Her Majesty’s Stationary Office. Medical Research Council Special Report
Series, London.
14. Sorsby A, Fraser GR. (1964) Statistical note on the components of ocular
refraction in twins. J Med Genet 55: 47–49.
15. Martin N, Boomsma D, Machin G. (1997) A twin-pronged attack on complex
traits. Nat Genet 17: 387–392.
16. Lopes MC, Andrew T, Carbonaro F, et al. (2009) Estimating heritability and
shared environmental effects for refractive error in twin and family studies.
Invest Ophthalmol Vis Sci 50: 126–131.
17. Lyhne N, Sjolie AK, Kyvik KO, Green A. (2001) The importance of genes and
environment for ocular refraction and its determiners: a population based
study among 20–45 year old twins. Br J Ophthalmol 85: 1470–1476.
18. Hammond CJ, Snieder H, Gilbert CE, Spector TD. (2001) Genes and envi-
ronment in refractive error: the twin eye study. Invest Ophthalmol Vis Sci 42:
1232–1236.
19. Hammond CJ, Andrew T, Mak YT, Spector TD. (2004) A susceptibility locus
for myopia in the normal population is linked to the PAX6 gene region on
chromosome 11: a genome-wide scan of dizygotic twins. Am J Hum Genet 75:
294–304.
20. Andrew T, Maniatis N, Carbonaro F, et al. (2008) Identification and replication
of three novel myopia common susceptibility gene loci on chromosome 3q26
using linkage and linkage disequilibrium mapping. PLoS Genet 4: e1000220.
21. Stambolian D, Ciner EB, Reider LC, et al. (2005) Genome-wide scan for
myopia in the Old Order Amish. Am J Ophthalmol 140: 469–476.
22. Schache M, Richardson AJ, Pertile KK, et al. (2007) Genetic mapping of
myopia susceptibility loci. Invest Ophthalmol Vis Sci 48: 4924–4929.
23. Dirani M, Chamberlain M, Shekar SN, et al. (2006) Heritability of refractive
error and ocular biometrics: the Genes in Myopia (GEM) twin study. Invest
Ophthalmol Vis Sci 47: 4756–4761.
24. Angi MR, Clementi M, Sardei C, et al. (1993) Heritability of myopic refractive
errors in identical and fraternal twins. Graefes Archive for Clinic Exper
Ophthalmol 231: 580–585.
198 M. Schäche and P.N. Baird
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 198
25. Zhu G, Hewitt AW, Ruddle JB, et al. (2008) Genetic dissection of myopia:
evidence for linkage of ocular axial length to chromosome 5q. Ophthalmology
115: 1053–1057 e1052.
26. He M, Hur YM, Zhang J, et al. (2008) Shared genetic determinant of axial
length, anterior chamber depth, and angle opening distance: the Guangzhou
Twin Eye Study. Invest Ophthalmol Vis Sci 49: 4790–4794. Epub 2008 Jun
4727.
27. Loehlin JC. (1996) The Cholesky approach: a cautionary note. Behav Genet
26: 65–69.
28. Access Economics Pty Ltd. (2004) Clear Insight: The Economic Impact and
Cost of Vision Loss in Australia. Melbourne.
29. Plomin R, DeFries JC, McClean GE, McGuffin P. (2001) Behavioral Genetics.
Worth Publishers, New York.
30. Chen CY, Scurrah KJ, Stankovich J, et al. (2007) Heritability and shared
environment estimates for myopia and associated ocular biometric traits: the
Genes in Myopia (GEM) family study. Hum Genet 112: 541–546.
31. Wojciechowski R, Congdon N, Bowie H, et al. (2005) Heritability of refractive
error and familial aggregation of myopia in an elderly American population.
Invest Ophthalmol Vis Sci 46: 1588–1592.
32. Grjibovski AM, Harris JR, Magnus P. (2005) Birth weight and adult health in
a population-based sample of Norwegian twins. Twin Res Hum Genet
8: 148–155.
33. Dirani M, Islam FM, Baird PN. (2009) The role of birth weight in myopia —
the genes in myopia twin study. Ophthalmic Res 41: 154–159. Epub 2009
Mar 2026.
34. Teikari JM. (1987) Myopia and stature. Acta Ophthalmol (Copenh). 65:
673–676.
35. Dirani M, Islam A, Baird PN. (2008) Body stature and myopia — The Genes
in Myopia (GEM) twin study. Ophthalmic Epidemiol 15: 135–139.
36. Dirani M, Shekar SN, Baird PN. (2008) The role of educational attainment in
refraction: the Genes in Myopia (GEM) twin study. Invest Ophthalmol Vis Sci
49: 534–538.
37. Hopper JL. (2002) The Australian Twin Registry. Twin Res 5: 329–336.
38. Dirani M, Chamberlain M, Garoufalis P, et al. (2008) Testing protocol and
recruitment in the genes in myopia twin study. Ophthalmic Epidemiol 15:
140–147.
39. Wright MJ, Martin NG. (2004) Brisbane Adolescent Twin Study: outline of
study methods and research projects. Aust J Psych 56: 65–78.
40. Spector TD, MacGregor AJ. (2002) The St. Thomas’ UK adult twin registry.
Twin Res 5: 440–443.
41. Skytthe A, Kyvik K, Bathum L, et al. (2006) The Danish Twin Registry in the
new millennium. Twin Res Hum Genet 9: 763–771.
199 Twins and Myopia
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 199
b846_Chapter-3.2.qxd 4/8/2010 1:59 AM Page 200
This page intentionally left blank This page intentionally left blank
TIGR, TGFB1, cMET, HGF, Collagen Genes,
and Myopia
Chiea-Chuen Khor*
The candidate gene approach is a feasible and widely employed method in
our search for disease genes. This approach has resulted in the identifica-
tion of many putative ‘susceptibility genes’ of which a majority could not
be subsequently replicated. This chapter summarizes recent findings in the
field of refractive error genetics, and proceeds to highlight some of the
prominent findings, which include the successful validation of MYP2,
MYP3, and COL2A1 as myopia susceptibility loci. The inherent weaknesses
of this approach, as well as the caveats to be mindful of in future studies,
are touched upon in the discussion.
Introduction
Myopia is a very common health problem in today’s developed world. The
prevalence varies significantly between ethnic groups, but individuals of
Asian descent, especially Chinese, have been shown to display a markedly
increased prevalence of myopia compared to Western populations. It
affects up to 40% of Chinese between the ages of 40 to 79 years. This
phenomenon is despite differing environmental and lifestyle conditions
in various ‘predominantly Chinese’ countries such as China, Singapore,
and Taiwan.
1,3–6
There are two forms of myopia that are distinguishable by aetiology.
The commoner ‘axial myopia’ results from a disproportionately rapid
increase of eye globe length during an individual’s growth phase.
201
3.3
*Division of Infectious Diseases, Genome Institute of Singapore, 60 Biopolis Street, Genome, Singapore
138672; +65 64788200. E-mail: [email protected]
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 201
‘Refractive myopia’ is less common comparatively, and is primarily due to
abnormal light diffraction caused by pathological changes in the refractive
elements of the eye: extreme corneal curvature, changes in lens density, or
increased refractive index of the ocular media (aqueous and vitreous
humor). For all forms of myopia, the image is focused in front of (rather
than exactly on) the retina; corrective lenses are thus necessarily convex in
nature.
The mechanism of disease pathogenesis for myopia has not been clearly
defined to date. However, it is generally agreed that whilst environmental
factors (e.g. near work, location of homestead) contribute strongly to the
disease process, there appears to be a considerable genetic contribution to
disease susceptibility and progression. Firstly, high hereditability estimates
for myopia related traits, such as spherical equivalent (SE, measured in
Diopters) and axial (eye-globe) length (AL, measured in millimeters) have
been previously shown.
7
Indeed, epidemiologic
8
and twin studies have
demonstrated a markedly increased risk between related individuals and
myopia (an increase in susceptibility of between 2.5 to 5.5 fold).
9–13
Secondly, family segregation studies also report a strong association
between parental myopia and myopia in their offspring.
14–17
Taken
together, all these data strongly implicate the contribution of genetic
factors to the pathogenesis of myopia.
To date, more than 14 genetic loci (with each locus implicating the
involvement of a genomic region larger than a million base pairs) have
been found to be tightly linked to myopia-related phenotypes via
family-based linkage studies. These have been designated as MYP loci
and numbered according to the chronological timeline of their
discovery.
18,19
One of these loci (MYP1, located on Chromosome Xq28)
has been implicated in Bornholm’s eye disease. Here, patients exhibit
X-linked high myopia, mild cone dysfunction, and color vision defects.
Other loci that appear to be highly penetrant are MYP2 (18p11.31) and
MYP3 (12q21-q23), both of which exhibit an autosomal-dominant
mode of inheritance. Subsequent replication studies of linkage at both
MYP2 and MYP3 by independent study groups lend further support to
the initial observations.
Despite these encouraging findings, many unanswered questions
remain; linkage studies have limited absolute resolution, and the majority
of linkage signals only point to broad genomic regions. As such, much
effort is required in the search for the actual genes and genetic variants
directly responsible for altered susceptibility to myopia within these large
202 C.-C. Khor
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 202
linkage regions. Indeed, a more thorough and finer-scale approach with
higher resolution is needed to achieve this aim.
Fortunately, the completion of the human genome project (2003) and
the wide availability of human haplotype maps (the international
HapMap project, completed in 2005; www.hapmap.org) has enabled fine-
scale mapping using single-nucleotide polymorphisms (SNPs). The rap-
idly declining cost of genotyping has also rendered this approach
economically practical, and in the last decade, candidate gene studies using
a high density marker set for analysis were performed widely for a broad
selection of complex-trait diseases. In addition to this, the advent of
genome-wide association studies have ushered in a new dawn for a more
‘unbiased,’ non-hypothesis-based search for disease genes, with encourag-
ing results. Turning to our focus on myopia susceptibility genes, we discuss
some current findings with a selection of candidate genes found to be
associated with myopia and its related endo-phenotypes.
Candidate Gene Selection Strategies for Myopia
Candidate genes for myopia susceptibility are genes that encode for a
protein product hypothesized to biologically influence individual suscep-
tibility, severity, or progression of myopia. They are normally chosen if
existing biological information or observations suggest their involvement
in disease pathogenesis. Variants within the selected gene(s) are then iden-
tified, genotyped, and analyzed for the presence of association with the
myopia phenotype studied (e.g. spherical equivalent, all-cause myopia,
severe myopia, axial length, and changes in these phenotypes over time).
The selection of candidate genes will be greatly facilitated if some of
the potentially important genes could be first linked to myopia via a
genome-wide screen. Thus, the combined ‘positional candidate’ approach
offers higher chance of success in identifying disease-causing polymor-
phisms; a pure candidate gene approach is not without its limitations, as
many genes have yet to be identified and researchers employing the can-
didate gene approach are limited to examining the genes that have been
described. More often than not, the candidate gene approach relies on
a priori information on the possible pathway for pathogenesis. As our
understanding of the molecular mechanisms underlying disease suscepti-
bility and progression of myopia is still limited, novel and crucial genes
might well be missed.
203 Candidate Genes in Myopia Susceptibility
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 203
Genes Associated With Myopia-Related Phenotypes
The HGF/cMET ligand-receptor axis
A widely studied candidate gene for myopia was Hepatocyte Growth
Factor (HGF). HGF has been shown to have a biologically relevant role in
ocular biology and is orthologous to Eye1, a major quantitative trait locus
that contributes to a variable rate of eye growth in the mouse.
20
HGF works by binding to its receptor cMET, a member of the tyrosine
kinase receptor family.
22
Once activated, the system triggers many cellular
responses, including cell division, migration, differentiation, and survival
of numerous cell types.
23
In the eye, HGF and cMET are expressed in the
lens, all three layers of the cornea, and in both fetal and adult retinal pig-
ment epithelium.
22,24–27
Natural genetic variants within HGF were first observed to be associ-
ated with high myopia in a family-based association study comprising
128 nuclear families of Chinese descent. One SNP in particular (HGF
rs3735520) showed evidence of association with very high myopia
(defined as SE ≤ –10.0 D), where the minor allele was observed to be
conferring increased risk of disease (P = 0.003).
21
However, a second
follow-up study enrolling 288 high myopia cases and 208 controls, also of
Chinese descent, failed to confirm association with this SNP.
28
A third
study, this time involving participants of European descent (the Duke–
Cardiff cohort), identified the rs3735520 SNP as associated with mild
to moderate myopia (SE from –0.50 to –5.00 D), but not with high
(SE ≤ –5.00 D) or very high myopia (SE ≤ –10.0 D). Of note, evidence of
association with high and very high myopia was observed with another
SNP within HGF (rs2286194) in the Duke–Cardiff cohort.
Observed associations with cMET genetic variants and myopia-
related phenotypes were more recent.
29
In a longitudinal cohort study,
which enrolled school children aged 7–12 years (Singapore cohort study
for risk factors of myopia; SCORM), a SNP within cMET (rs2073560)
was found to be associated with an increased risk of myopia in general
(SE ≤ –0.5 D). Longitudinal analysis showed that the variant allele also
was associated with more rapid change in refractive error over time
regardless of the initial refractive state. However, due to its location
within the non-coding region of cMET, this SNP is unlikely to be the
causative genetic variant responsible for the observed associations.
Thus, further efforts involving direct sequencing of all coding and
204 C.-C. Khor
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 204
regulatory regions of cMET are needed to define the biologically relevant
mutations.
Transforming growth factor-β (TGFB1)
Axial myopia is the commoner form of myopia compared to refractive
myopia,
30
and active scleral remodeling has been shown to play a crucial
role in axial (globe) elongation, at least in animal models of myopia.
31,32
One such gene that could be involved in the process of scleral remodeling
is the one encoding for transforming growth factor-β (TGF-β, encoded by
the TGFB1 gene). TGF-β is expressed in ocular tissues
33
and its concentra-
tions in the retinal pigmented epithelium, choroid, and the sclera have
been found to be significantly reduced in myopic eyes. In addition, TGF-β
is known to regulate the proliferation of fibroblasts, as well as the produc-
tion of collagen, matrix metalloproteinases (MMP), and tissue inhibitors
of MMP.
34
All these processes contribute to the biology of scleral remod-
eling and consequent axial length change.
35
Given all these prior biological information on the potential influence
of TGF-β on axial length, it is unsurprising that natural genetic variation
within TGFB1 has long been suspected to modify susceptibility to refrac-
tive errors, especially axial myopia. Indeed, a SNP within TGFB1
(rs1800470) has been found to associate with severe myopia in a study
involving 201 severe myopia cases (SE ≤ –6.0D) and 86 controls of Chinese
descent from Taiwan. Here, the minor T allele was shown to be at reduced
risk of severe myopia (OR = 0.55, 95%CI: 0.37 — 0.80; P = 0.001).
36
This
association was replicated in a second cohort involving 300 severe myopia
cases (SE ≤ –8.0D) and 300 controls of Southern Chinese descent (OR =
0.72, 95%CI: 0.57 — 0.90; P = 0.004).
37
However, in this second Chinese
study,
37
a previous SNP that was not assessed in the original study
(rs4803455) was found to be much more strongly associated with
decreased susceptibility towards severe myopia (OR = 0.66, 95%CI:
0.52–0.84; P = 4.9 × 10
–4
) compared with rs1800470. As such, SNP rs4803455
is a closer correlate for severe myopia compared to SNP rs1800470.
Notably, a Japanese high myopia study (SE ≤ –9.25), which included 330
cases and 330 controls, failed to detect any association with 10 TGFB1
SNPs. However, neither rs1800470 nor rs4803455 were genotyped in the
Japanese study. A second study showing non-replication of TGFB1 genetic
variants also could not be adequately assessed, as only 1 SNP was typed;
again, neither rs1800470 nor rs4803535 were analyzed.
205 Candidate Genes in Myopia Susceptibility
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 205
In the Singapore-based SCORM cohort, recessive carriage of the minor
T allele at rs4803455 was found to be associated with decreased suscepti-
bility to severe myopia (SE ≤ –5.0D)(OR = 0.46, 95%CI: 0.19–1.05; two-
tailed P = 0.046) (SCORM unpublished findings). These individuals
also had on average shorter axial lengths (0.21 mm shorter on average,
P = 0.05) compared to wild-type individuals, thus lending further support
to the two previous Chinese studies and also supporting a role for TGFB1
and axial myopia.
Trabecular-meshwork inducible glucocorticoid
response (TIGR) gene
TIGR was first identified as a susceptibility gene for primary open angle
glaucoma,
38
but more recent data suggests that it could also be a suscepti-
bility gene for high myopia.
39,40
This is in keeping with clinical observa-
tions documenting an increased frequency of open-angle glaucoma in
individuals with high-myopia. An increased prevalence of myopia in
patients with glaucoma was also observed.
39
The protein encoded by TIGR is myocillin (MYOC). It has been found
to be expressed widely in ocular tissues (e.g. the choroid, cilliary bodies,
sclera, and trabecular meshwork),
41
and studies have shown that the
expression of myocilin in the trebecular meshwork is affected by TGF-β
(see previous section on TGFB1) and mechanical stretch.
Findings from previous studies investigating the association between
genetic variants at the TIGR locus and severe myopia have yielded slightly
inconsistent results. In a family-based association study conducted in
Hong Kong involving 162 Chinese nuclear families (overall n = 557), two
microsatellite polymorphisms flanking TIGR and two SNPs (rs2421853
and rs235858) within the 3′ untranslated region of the gene were shown
to be associated with high myopia (SE ≤ –6.0 D) (lowest P = 4 × 10
–6
).
39
A
second, smaller case-control study (n = 70 severe myopia cases and
69 non-myopic controls) from Hong Kong was unable to demonstrate
evidence of association with one of the microsatellite markers reported
(–339(GT)12–16; NGA17).
42
Notably, this second Hong Kong-based
study did not assess the remaining three polymorphisms (microsatellite
NGA19, and SNPs rs2421853 and rs235858), thus rendering it of limited
value in demonstrating lack of association.
A subsequent reassessment of these four genetic markers consisting
of over 1000 Caucasian subjects (the Duke–Cardiff cohort) also did not
206 C.-C. Khor
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 206
replicate evidence of association with these four TIGR polymorphisms.
40
Instead, the Duke–Cardiff cohort showed that SNP rs1684720 (which was
previously not tested in the Hong Kong study but is in linkage disequilib-
rium (LD) with the other two SNPs in East Asians) was consistently asso-
ciated with high myopia in both the case control and family-based
approach. In the Singaporean SCORM cohort, association was observed
for SNP rs1684720 with a more negative population-wide SE (P = 0.032)
in general, and severe myopia in particular (SE ≤ –5.0 D)(P = 0.048;
SCORM cohort). (SCORM unpublished findings.) Although inconsistent
with regards to the exact SNPs involved in the association signal, these
findings are nonetheless supportive of a role for TIGR genetic variants and
increased susceptibility to severe myopia.
The collagen family of genes
Collagen makes up about 30 percent of total body protein and is a basic
building block for human connective tissue. Colagen provides structure
and tensile strength to many important body components (e.g. skin,
bone, cartilage, and finer structures, such as blood vessels and the sclera).
As 90 percent of the human sclera is primarily an ECM of collagen fibrils
(mainly type I fibrils),
32
genes encoding for the collagen family of proteins
are natural candidates for study in myopia pathogenesis and development.
Scleral thinning has been attributed to a general loss of ECM (see previ-
ous section on TGFB1),
43
and studies in animal models such as tree shrews
have revealed that myopic eyes typically suffer from thinned and weakened
sclerae, which are less capable of withstanding the expansive forces of a
positive intraocular pressure. It is thus hardly surprising that one charac-
teristic feature of axial myopia is an elongated eyeball.
44
At the cellular level, amounts of collagen mRNA at steady state before
and after monocular visual form-deprivation has been well correlated;
deprived-eye scleras are myopic and have less collagen mRNA, whereas
recovering eye scleras have more.
45
Such findings are in keeping with the
observation that visual form-deprivation produces a more extensible
sclera, and that recovery from form-deprivation reduces the extensibility
of the sclera.
46,47
Currently, the two most well-studied collagen genes in
myopia pathogenesis are COL1A1 and COL2A1, encoding for the α1 and
α2 chains of type I collagen respectively.
Rare function-altering genetic mutations in COL1A1 have been found
to be associated with two distinct connective tissue diseases: osteogenesis
207 Candidate Genes in Myopia Susceptibility
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 207
imperfecta and Ehlers–Danlos syndrome. For both disorders, the clinical
phenotype is a result of compromised type-I collagen structure. Studies
assessing the role of genetic polymorphisms in COL1A1 and susceptibility
to myopia first appeared with Asian cohorts. Conflicting results were
observed; a Taiwan-based study with 471 severe myopia (SE ≤ –6.0D)
cases and 623 controls of Chinese ethnicity could not detect evidence of
association with COL1A1 genetic variants after assessing 10 representative
‘tagging’ markers.
48
In contrast, a Japanese study with 330 severe myopia
cases (SE ≤ –9.25 D) and 330 controls managed to detect association with
COL1A1 SNPs rs2075555 and rs2269336.
49
However, a second Japanese
study using 427 severe myopia cases (SE ≤ –5.0 D) and 420 controls failed
to find association with these two SNPs.
50
Data from the SCORM cohort
involving Singaporean Chinese also failed to confirm evidence of associa-
tion (SCORM unpublished findings). Thus, the current evidence with
COL1A1 is not conclusive of association with myopia.
Moving on to COL2A1, where severe gene disruptions during foetal
development could result in Stickler’s syndrome, a different picture is
observed. Stickler’s syndrome (congenital, progressive arthro-ophthal-
mopathy) is an autosomal dominant form of collagenopathy (disease due
to abnormal synthesis of collagen), whereby affected children have a dis-
tinct facial appearance, eye abnormalities, hearing loss, and joint prob-
lems. It has been observed that many patients with COL2A1 Stickler
syndrome suffer from a mono-genic form of severe ‘nearsightedness’
(described as having high myopia) due to the inherently abnormal shape
of the eye. In light of these findings with these highly penetrant genetic
mutations, it was hypothesized that commoner and less penetrant genetic
variants within COL2A1 could also modify individual susceptibility to less
severe forms of myopia.
In a family-based study involving 123 nuclear families of mixed (but
predominantly Caucasian; 62%) ethnicity, strong evidence of association
with common myopia (SE ≤ –0.75 D) was detected for one COL2A1 SNP
(rs1635529, P = 7.0 × 10
–5
).
51
A second study (the Duke–Cardiff cohort)
also showed supporting evidence of association for this particular SNP
with common (SE ≤ –0.5 D; P < 0.05 in Duke) and high-grade myopia
(SE ≤ –5.0D; P < 0.05 in Duke). Further replication was achieved in the
Cardiff cohort (P = 0.007 for common myopia, and P = 0.004 for high-
grade myopia).
52
Compared to COL1A1, the evidence of association for
COL2A1 and the myopia trait is more robust. Although SNP rs1635529
208 C.-C. Khor
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 208
has yet to be assessed in the Singaporean SCORM cohort, the evidence for
association observed in the Caucasian cohorts thus far are convincing.
Concluding Remarks
In conclusion, some clear patterns are emerging in the field of refractive
error genetics. Altered susceptibility to myopia in humans appears to be
highly polygenic with many genetic loci initially implicated, but only a
minority of these have been convincingly replicated in subsequent studies.
Most identified loci have relatively small effects with low odds ratios (< 3),
the exceptions being monogenic disorders, which also result in severe
myopia (e.g. Stickler’s syndrome). Genome-wide linkage analysis of fam-
ily members (e.g. twins) has recently shown some success in defining
broad susceptibility loci for myopia. Despite this, many follow-up studies
leading from genome-wide linkage analysis fail to identify the causative
genetic variants underlying the broad linkage peaks.
Heterogeneity of genotypic and allelic association findings are fre-
quently observed when comparing results between different study cohorts.
The most obvious cause for this is the non-uniform phenotype definition
across study populations (e.g. definitions of myopia vary from between
SE ≤ –0.5 D to SE ≤ –0.75 D across studies, with some considering SE ≤
–1.0 D; for severe myopia, definitions have varied from SE ≤ –5.0D to
SE ≤ –10.0 D). Other possible reasons include different susceptibility genes
for different ethnic groups, as well as undetected epistasis within certain
population groups, which may mask true associations. As the contribution
of environmental factors to myopia pathogenesis is considerable, future
efforts should involve more precise inclusion of environmental covariates
within multi-variate modelling frameworks in the attempt to accurately
control for them in genetic studies. Finally, the possibility of a considerable
number of these results being false positives should not be dismissed.
These provisional conclusions are currently being altered by the great
promise of genome-wide association studies that could revolutionize our
approach to the genetic analysis of myopia. Indeed, platforms that simulta-
neously genotype a million SNPs in each participating individual are now
widely available. The recent availability of genome-wide interrogation of
structural variants (e.g. copy number variants) and second generation ‘deep
sequencing’ facilities will enable researchers to take into account the ‘total
209 Candidate Genes in Myopia Susceptibility
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 209
individual genetic variation’ beyond single-marker analysis. This will allow
for much improved genotype-phenotype correlation using advanced
analysis frameworks, and advance our understanding in the pathogenesis
mechanisms of myopia development and progression.
Acknowledgments
The Agency for Science, Technology and Research (A-STAR), and the
National University of Singapore — Genome Institute of Singapore
(NUS — GIS) Center for Molecular Epidemiology (CME) provided
funding for the SCORM studies. The author is an A-STAR scholar and
currently holds an adjunct appointment at the NUS-GIS CME.
References
1. Wong TY, Foster PJ, Hee J, et al. (2000) Prevalence and risk factors for refrac-
tive errors in adult Chinese in Singapore. Invest Ophthalmol Vis Sci 41:
2486–2494.
2. Seet B, Wong TY, Tan DT, et al. (2001) Myopia in Singapore: taking a public
health approach. Br J Ophthalmol 85: 521–526.
3. Saw SM, Chua WH, Hong CY, et al. (2002) Nearwork in early-onset myopia.
Invest Ophthalmol Vis Sci 43: 332–339.
4. Lin LL, Shih YF, Tsai CB, et al. (1999) Epidemiologic study of ocular refrac-
tion among schoolchildren in Taiwan in 1995. Optom Vis Sci 76: 275–281.
5. Zhao J, Pan X, Sui R, et al. (2000) Refractive error study in children: results
from Shunyi District, China. Am J Ophthalmol 129: 427–435.
6. Wu HM, Seet B, Yap EP, et al. (2001) Does education explain ethnic differ-
ences in myopia prevalence? A population-based study of young adult males
in Singapore. Optom Vis Sci 78: 234–239.
7. Klein AP, Suktitipat B, Duggal P, et al. (2009) Heritability analysis of spherical
equivalent, axial length, corneal curvature, and anterior chamber depth in the
Beaver Dam Eye Study. Arch Ophthalmol 127: 649–655.
8. Liang CL, Yen E, Su JY, et al. (2004) Impact of family history of high myopia
on level and onset of myopia. Invest Ophthalmol Vis Sci 45: 3446–3452.
9. Lin LL, Chen CJ. (1987) Twin study on myopia. Acta Genet Med Gemellol
(Roma). 36: 535–540.
10. Teikari JM, Kaprio J, Koskenvuo MK, Vannas A. (1988) Heritability estimate
for refractive errors — a population-based sample of adult twins. Genet
Epidemiol 5: 171–181.
210 C.-C. Khor
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 210
11. Hammond CJ, Snieder H, Gilbert CE, Spector TD. (2001) Genes and envi-
ronment in refractive error: the twin eye study. Invest Ophthalmol Vis Sci 42:
1232–1236.
12. Lyhne N, Sjolie AK, Kyvik KO, Green A. (2001) The importance of genes and
environment for ocular refraction and its determiners: a population based
study among 20–45 year old twins. Br J Ophthalmol 85: 1470–1476.
13. Stambolian D, Ibay G, Reider L, et al. (2004) Genome-wide linkage scan for
myopia susceptibility loci among Ashkenazi Jewish families shows evidence of
linkage on chromosome 22q12. Am J Hum Genet 75: 448–459.
14. Mutti DO, Mitchell GL, Moeschberger ML, et al. (2002) Parental myopia, near
work, school achievement, and children’s refractive error. Invest Ophthalmol
Vis Sci 43: 3633–3640.
15. Wu MM, Edwards MH. (1999) The effect of having myopic parents: an
analysis of myopia in three generations. Optom Vis Sci 76: 387–392.
16. Pacella R, McLellan J, Grice K, et al. (1999) Role of genetic factors in the
etiology of juvenile-onset myopia based on a longitudinal study of refractive
error. Optom Vis Sci 76: 381–386.
17. Yap M, Wu M, Liu ZM, et al. (1993) Role of heredity in the genesis of myopia.
Ophthalmic Physiol Opt 13: 316–319.
18. Chen CY, Stankovich J, Scurrah KJ, et al. (2007) Linkage replication of the
MYP12 locus in common myopia. Invest Ophthalmol Vis Sci 48: 4433–4439.
19. Wojciechowski R, Stambolian D, Ciner E, et al. (2009) Genome-wide linkage
scans for ocular refraction and meta-analysis of four populations in the
Myopia Family Study. Invest Ophthalmol Vis Sci 50: 2024–2032.
20. Zhou G, Williams RW. (1999) Eye1 and Eye2: gene loci that modulate eye size,
lens weight, and retinal area in the mouse. Invest Ophthalmol Vis Sci 40:
817–825.
21. Han W, Yap MK, Wang J, Yip SP. (2006) Family-based association analysis of
hepatocyte growth factor (HGF) gene polymorphisms in high myopia. Invest
Ophthalmol Vis Sci 47: 2291–2299.
22. Wormstone IM, Tamiya S, Marcantonio JM, Reddan JR. (2000) Hepatocyte
growth factor function and c-Met expression in human lens epithelial cells.
Invest Ophthalmol Vis Sci 41: 4216–4222.
23. Ma PC, Maulik G, Christensen J, Salgia R. (2003) c-Met: structure, func-
tions and potential for therapeutic inhibition. Cancer Metastasis Rev 22:
309–325.
24. Weng J, Liang Q, Mohan RR, et al. (1997) Hepatocyte growth factor, ker-
atinocyte growth factor, and other growth factor-receptor systems in the lens.
Invest Ophthalmol Vis Sci 38: 1543–1554.
25. Li Q, Weng J, Mohan RR, et al. (1996) Hepatocyte growth factor and hepato-
cyte growth factor receptor in the lacrimal gland, tears, and cornea. Invest
Ophthalmol Vis Sci 37: 727–739.
211 Candidate Genes in Myopia Susceptibility
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 211
26. Wilson SE, Walker JW, Chwang EL, He YG. (1993) Hepatocyte growth factor,
keratinocyte growth factor, their receptors, fibroblast growth factor receptor-
2, and the cells of the cornea. Invest Ophthalmol Vis Sci 34: 2544–2561.
27. He PM, He S, Garner JA, et al. (1998) Retinal pigment epithelial cells secrete
and respond to hepatocyte growth factor. Biochem Biophys Res Commun 249:
253–257.
28. Wang P, Li S, Xiao X, et al. (2009) High myopia is not associated with the SNPs
in the TGIF, lumican, TGFB1, and HGF genes. Invest Ophthalmol Vis Sci 50:
1546–1551.
29. Khor CC, Grignani R, Ng DP, et al. (2009) cMET and Refractive Error
Progression in Children. Ophthalmology 116: 1469–1474.
30. Zadnik K. (1997) Myopia development in childhood. Optom Vis Sci 74:
603–608.
31. McBrien NA, Gentle A. (2003) Role of the sclera in the development and
pathological complications of myopia. Prog Retin Eye Res 22: 307–338.
32. Rada JA, Shelton S, Norton TT. (2006) The sclera and myopia. Exp Eye Res 82:
185–200.
33. Saika S. (2006) TGF-β pathobiology in the eye. Lab Invest 86: 106–115.
34. Overall CM, Wrana JL, Sodek J. (1989) Independent regulation of collagenase,
72-kDa progelatinase, and metalloendoproteinase inhibitor expression in
human fibroblasts by transforming growth factor-B. J Biol Chem 264:
1860–1869.
35. Rada JA, Thoft RA, Hassell JR. (1991) Increased aggrecan (cartilage proteo-
glycan) production in the sclera of myopic chicks. Dev Biol 147: 303–312.
36. Lin HJ, Wan L, Tsai Y, et al. (2006) The TGFbeta1 gene codon 10 polymor-
phism contributes to the genetic predisposition to high myopia. Mol Vis 12:
698–703.
37. Zha Y, Leung KH, Lo KK, et al. (2009) TGFB1 as a susceptibility gene for high
myopia: a replication study with new findings. Arch Ophthalmol 127:
541–548.
38. Stone EM, Fingert JH, Alward WL, et al. (1997) Identification of a gene that
causes primary open angle glaucoma. Science 275: 668–670.
39. Tang WC, Yip SP, Lo KK, et al. (2007) Linkage and association of myocilin
(MYOC) polymorphisms with high myopia in a Chinese population. Mol Vis
13: 534–544.
40. Zayats T, Yanovitch T, Creer RC, et al. (2009) Myocilin polymorphisms and
high myopia in subjects of European origin. Mol Vis 15: 213–222.
41. Adam MF, Belmouden A, Binisti P, et al. (1997) Recurrent mutations in a
single exon encoding the evolutionarily conserved olfactomedin-homology
domain of TIGR in familial open-angle glaucoma. Hum Mol Genet 6:
2091–2097.
212 C.-C. Khor
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 212
42. Leung YF, Tam PO, Baum L, et al. (2000) TIGR/MYOC proximal promoter
GT-repeat polymorphism is not associated with myopia. Hum Mutat 16: 533.
43. Gentle A, Liu Y, Martin JE, et al. (2003) Collagen gene expression and the
altered accumulation of scleral collagen during the development of high
myopia. J Biol Chem 278: 16587–16594.
44. Phillips JR, McBrien NA. (1995) Form deprivation myopia: elastic properties
of sclera. Ophthalmic Physiol Opt 15: 357–362.
45. Siegwart JT, Jr, Norton TT. (2001) Steady state mRNA levels in tree shrew
sclera with form-deprivation myopia and during recovery. Invest Ophthalmol
Vis Sci 42: 1153–1159.
46. Siegwart JT, Jr, Norton TT. (1999) Regulation of the mechanical properties of
tree shrew sclera by the visual environment. Vision Res 39: 387–407.
47. Phillips JR, Khalaj M, McBrien NA. (2000) Induced myopia associated with
increased scleral creep in chick and tree shrew eyes. Invest Ophthalmol Vis Sci
41: 2028–2034.
48. Liang CL, Hung KS, Tsai YY, et al. (2007) Systematic assessment of the
tagging polymorphisms of the COL1A1 gene for high myopia. J Hum Genet
52: 374–377.
49. Inamori Y, Ota M, Inoko H, et al. (2007) The COL1A1 gene and high myopia
susceptibility in Japanese. Hum Genet 122: 151–157.
50. Nakanishi H, Yamada R, Gotoh N, et al. (2009) Absence of association
between COL1A1 polymorphisms and high myopia in the Japanese popula-
tion. Invest Ophthalmol Vis Sci 50: 544–550.
51. Mutti DO, Cooper ME, O’Brien S, et al. (2007) Candidate gene and locus
analysis of myopia. Mol Vis 13: 1012–1019.
52. Metlapally R, Li YJ, Tran-Viet KN, et al. (2009) COL1A1, COL2A1 genes and
myopia susceptibility: evidence of association and suggestive linkage to the
COL2A1 locus. Invest Ophthalmol Vis Sci [Epub ahead of print].
213 Candidate Genes in Myopia Susceptibility
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 213
b846_Chapter-3.3.qxd 4/8/2010 2:00 AM Page 214
This page intentionally left blank This page intentionally left blank
Statistical Analysis of Genome-wide
Association Studies for Myopia
Yi-Ju Li*
,†
and Qiao Fan

Genome wide association (GWA) studies have become a powerful approach
for identifying genetic loci or susceptibility genes for common complex
diseases. While the number of susceptibility loci identified by GWA studies
is increasing, GWA studies for myopia are lagging behind many complex
diseases. However, it is expected that more GWA studies related to myopia
phenotypes will be reported in the near future. In this chapter, we describe
the aspects of statistical analysis of the GWA study for myopia, including
study design, quality control procedures, methods for association tests, and
myopia related analysis issues.
Introduction
The path of identifying the underlying genetic factors for complex human
disease has primarily relied on two study designs: (1) genome wide link-
age screens to narrow down the chromosomal regions that are linked to
the disease gene(s) or quantitative trait loci (QTL); (2) association studies
to detect the genetic variants that may lead to the identification of suscep-
tibility genes or genetic modifiers for the traits of interest. In 1996, Risch
and Merikangas
1
predicted that “the future of the genetics of complex
diseases is likely to require large-scale testing by association analysis.” They
demonstrated analytically that family-based association studies could have
substantially more power than standard linkage analysis, particularly to
215
3.4
*Department of Biostatistics and Bioinformatics, Duke University Medical Center, Durham, NC
27710, USA. E-mail: [email protected]

Center for Human Genetics, Duke University Medical Center, Durham, NC 27710, USA

Department of Epidemiology and Public Health, National University of Singapore, Singapore.
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 215
detect genes with small to moderate genetic effects on disease risk as
expected in complex diseases. The caveat to their conclusion is that a suf-
ficient density of markers must be screened to ensure that the actual dis-
ease locus, or one in strong linkage disequilibrium (LD) with the disease
locus, will be tested. With the availability of genome wide high-density
single-nucleotide polymorphism (SNP) arrays (or SNP chips), genome
wide association (GWA) studies have become feasible to achieve
“large-scale” association testing. In the past few years, GWA studies
have proven to be a powerful approach to uncover new disease genes or
genetic loci for several different diseases.
2
The genetic basis of myopia is supported by data from familial aggrega-
tion, segregation, and twin studies. The review of genetic studies of
myopia to date can be found in Chapters 3.1–3.5 [Note: refer to Chapters
by Drs. Young, Baird, and Khor]. Almost all studies were based on the
framework of genome wide linkage scans, association study for selected
candidate genes, or sequencing of the promoter and exons of candidate
genes to identify functional variants. Although the number of GWA pub-
lications is growing in the past few years, no GWA reports for myopia or
its related phenotypes have been published until recently by Nakanishi
et al.,
3
for which they identified a chromosome 11q24.1 locus for the
pathological myopia (high myopia with axial length > 28.0 mm in both
eyes), a selected subgroup of high myopia. To our knowledge, several
myopia-related GWA studies are underway, particularly using existing epi-
demiologic cohorts of myopia, at the time of writing this chapter. It is
expected that more GWA papers will be published within a year or two.
Unlike association studies of candidate genes that are limited to specific
biological function or chromosome regions of interest, GWA studies utilize
hundreds of thousands of markers across the genome to evaluate the asso-
ciation between markers and disease-related phenotypes on the genome-
wide scale. The GWA study is considered an unbiased approach to survey
most of the genome for susceptible or causal variants since no assump-
tions are made for any pre-selected regions or genes for association tests.
While this approach is more comprehensive than conventional candidate
gene association studies, several layers of challenges have arisen due to the
significantly increased data and tests that we face for the GWA study. In the
following sections, we will provide a general review of conducting a GWA
study and relate it to myopia. Through this chapter, examples illustrated
were obtained from the GWA data of 929 Chinese samples from Singapore
Cohort Study of the Risk factors for Myopia (SCORM), for which
216 Y.J. Li and Q. Fan
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 216
genotyping was conducted using Illumina HumanHap 550 (http://www.
illumina.com/).
Phenotypes for Myopia Genetic Studies
The diagnosis of myopia is determined by refractive errors, sphere (SPH),
or spherical equivalent (SE = sphere + 1/2(cylinder)). The most frequently
studied phenotypes in myopia genetic studies are various dichotomous
disease states of myopia (e.g. common myopia, moderate myopia, high
myopia) defined by different thresholds of SPH or SE. Among them, high
myopia was probably investigated the most, resulting in 10 out of 16 MYP
loci reported to link to high myopia.
4–13
In contrast, the uses of quantita-
tive refractive errors for myopia genetic studies are much fewer.
14
Furthermore, although other ocular biometrics, such as axial length, ante-
rior chamber depth, and corneal curvature, are highly correlated to refrac-
tion error, contribute to the determination of refraction, and show high
heritability in families,
15
they have not been widely investigated for genetic
association. Clearly, these ocular biometrics are valuable endophenotypes
for searching genes that may affect myopia development.
In Table 1, we listed several quantitative ocular biometrics and dichoto-
mous disease states of myopia that can be considered for genetic associa-
tion studies. Even with the most frequently studied dichotomous
phenotypes such as myopia and high myopia, the definition of various
myopic states was not standardized in the myopia genetic research com-
munity. SPH and SE have been used alternatively in the literature for
defining the disease state of myopia. In addition, different thresholds of
refraction error (in diopters (D)) have been used for declaring the severity
of myopia. For instance, −6.00 D or −5.00 D have been alternatively used
as the threshold for defining high myopia.
Considering the needs of replication evidence for GWA studies, investi-
gators should be mindful of the consistency in phenotypes across studies.
With the lack of a gold standard on defining various degrees of myopia
diseases status, one will need to make sure that the same thresholds or def-
inition of myopia cases and controls are consistent across all datasets to be
investigated.
An additional caveat of myopia related phenotypes is that each biomet-
ric measure can be obtained from right and left eyes. An affected status of
myopia is mostly defined when at least one eye reaches the given threshold
217 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 217
2
1
8
Y
.
J
.

L
i

a
n
d

Q
.

F
a
n
Table 1. Phenotypes for Myopia
Phenotype Category Heritability Definition Reference
Sphere (SPH) Quantitative 0.24 — Young et al., 2009
61
Spherical Equivalent (SE) Quantitative 0.578 (0.127) SPH + Cylinder/2 Klein et al., 2009
62
Axial length Quantitative 0.674 (0.136) —
Corneal curvature Quantitative 0.685 (0.128) —
Anterior chamber depth Quantitative 0.779 (0.142) —
Any myopia Binary — SPH or SE ≤ –0.50 D Metlapally et al., 2009
63
;
Pertile et al. 2008
64
;
SPH or SE ≤ –0.75 D Mutti et al. 2007
65
;
SPH or SE ≤ –1.00 D Stambolian et al. 2004
66
;
Ibay et al. 2004
67
Moderate myopia Binary — SPH or SE ≤ –3.00 D Heath et al. 2001
68
High myopia Binary — SPH or SE ≤ –5.00 D Yanovitch et al. 2009
69
;
or Metlapally et al. 2009
63
;
SPH or SE ≤ –6.00 D Han et al. 2009
70
;
Liang et al. 2007
71
b
8
4
6
_
C
h
a
p
t
e
r
-
3
.
4
.
q
x
d


4
/
8
/
2
0
1
0


2
:
0
0

A
M


P
a
g
e

2
1
8
of refractive errors, and unaffected status is defined when both eyes do not
reach the threshold. However, for quantitative phenotypes, we face the
question whether the analysis should be conducted for each eye, inde-
pendently, or a summary form of the two eyes. Furthermore, how should
we interpret results if right and left eyes lead to discordant findings? We
will discuss this topic further in the correlated phenotype section.
Study Design
Statistical methods have strong influences on the study design of any
research projects. This is the same for association studies in the human
genetic field. Two primary study designs are case-control and family-based
association studies. The former uses unrelated population-based case-
control samples, and the latter uses familial samples such as parents and
full-siblings.
Case-control design is known to have a higher statistical power than
family-based design under the same sample size, but the results are
strongly influenced by sample selection.
16
In addition, case-control design
tends to be prone to spurious association results due to undetected latent
population structure. However, the reservation of using case-control study
design has been changed significantly since the development of several
sophisticated statistical methods, including GENOMIC CONTROL,
17
STRUCTURE,
18
and EIGENSTRAT,
19
which can minimize the effect of
population structure to the association tests of unrelated samples. While
these two study designs still possess distinct advantages over each other,
sample availability is often the primary driving force for the selection of
the study design. The epidemiology study of myopia has a larger and ear-
lier research community than the genetic study of myopia. Several epi-
demiology cohorts of myopia have specimen collected from participants,
which provide a great resource for myopia genetic research. Likewise, sim-
ilar to most of GWA studies published to date, most GWA studies for
myopia will be primarily based on population-based samples due to the
sample resources and the total genotyping cost.
Although the cost per genotype is decreasing, the total cost of a GWA
study is still high. Two-stage or multi-stage design has been proposed for
the purpose of retaining statistical power and reducing the genotyping
cost.
20–22
The idea of two-stage design is to conduct the GWA study in the
first set of samples at the reasonable and affordable size (first-stage), and
219 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 219
follow-up a subset of SNPs in another independent samples (second-
stage). Skol et al.
20
suggested performing joint analysis for pooled samples
from both stages in order to maximize the power of detecting significance,
which is different from the conventional view of replication that considers
the second stage results as an independent dataset. Regardless which
analytical approaches were taken, the best practice of declaring GWA find-
ings is to seek out replication evidence in as many independent datasets
as possible.
Genotyping and Quality Controls
GWA studies rely on commercial SNP chips, predominantly by Affymetrix
(http://www.affymetrix.com/) and Illumina (http://www.illumina.com/).
The current available SNP chips (>300 K SNPs) all have the ability to
detect copy number variants (CNVs), which refer to the chromosomal
deletions or duplications. This makes GWA studies more attractive as one
can investigate both SNP and CNV association with phenotypes of inter-
est at the same time. The most commonly used criteria for selecting SNP
chips is the global coverage across the genome, that is, the fraction of com-
mon SNPs that are tagged by the SNPs on the chips.
23–25
The latest prod-
ucts, Affymetrix Human SNP array 6.0 and Illumina HamanOmni1-Quad,
are indeed aiming for this goal with the dramatically increased number of
SNPs on the chips compared to their earlier products. The Affymetrix 6.0
includes more than 906,600 single nucleotide polymorphisms (SNPs) and
more than 946,000 additional probes for the detection of copy number
variation (CNVs). The Illumina HumanOmni1-Quad BeadChip, a com-
pletely redesigned array of HumanlM-Duo, contains over 1 million mark-
ers, including aggressively selected SNPs and probes from all three
HapMap phases, the 1000 Genome project (http://www.1000genomes.
org/page.php), and published studies. Specifically, it contains ~18 K SNPs
targeting four 1 Mb regions known to be associated with human diseases;
over 62 K non-synonymous SNPs; and SNPs targeting new coding vari-
ants. This chip has a median spacing of 1.5 kb to ensure high resolution
for CNV detection. Although studies using these newly marketed SNP
chips have not been reported, this level of global coverage will indeed
increase the power for GWA studies.
Regardless what types of SNP chips are used, a rigorous quality control
(QC) procedure is very important to ensuring the success of the study.
220 Y.J. Li and Q. Fan
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 220
While both Affymetrix and Illumina have their own genotype calling algo-
rithms for raw data analysis, one should make sure that the best practice
of genotype calling protocol is applied.
26
Several QC check points are often
examined in the GWA study, including sample call rate, Hardy–Weinberg
equilibrium (HWE) for each marker using control samples, minor allele
frequency (MAF), genotype missingness per marker, and population
structure. Although there is no gold standard for these QC check points,
examples of thresholds that we would recommend are: excluding samples
with call rates <96% or <98%,
26
and excluding SNPs that are out of HWE
( p < 10
–7
) in control samples, MAF < 0.01, or genotype missingness >10%.
Population structure is another important QC task to investigate. More
details are described in the next section.
Population Structure
Early views of the role of population structure in genetic association studies
of unrelated individuals focused on the concern that cryptic population
substructure would raise the false positive rate of statistical tests above their
nominal level. For instance, in a case-control dataset, assume there are two
underlying subpopulations with different allele frequencies at the SNP and
the number of cases is disproportionally high in one subpopulation. Under
this scenario, failure to account for population stratification, a confound-
ing factor of allele frequencies differences, could result in significant false
positive association between SNPs and disease status.
A conventional approach is to select a homogenous dataset as best as
you can at the design stage, such as matching cases and controls to mini-
mize the population stratification effect. However, most studies have sub-
tle stratification or have difficulty matching epidemiological or
environmental background. Interestingly, the GWA study from the
Wellcome Trust Case Control Consortium (WTCCC) study has demon-
strated that as long as cases and controls are well matched for broad eth-
nic backgrounds and solid exclusion criteria are in place, the impact of
residual substructure has minimum effect on type I error.
2
Concern over the false positive rates by population-based association
studies has led to a number of different approaches to control the presence
of population structure, including “genomic control,”
17
clustering
methods, such as STRUCTURE and STRAT methods,
18,27
principle com-
ponents analysis (PCA), and alternative family-based study designs.
221 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 221
Genomic control requires data on null SNPs to estimate a variance infla-
tion factor that is used to directly correct the test statistic.
28
However, the
assumption that the inflation factor is globally consistent across a whole
genome might simplify the variations between SNPs. Hence adjustment
for the inflation factor is preferred after addressing population substruc-
ture in a certain level, such as applying the GC method in a dataset that
may have similar background (less heterogeneous).
A different approach, implemented in STRUCTURE and STRAT soft-
ware,
18,27
(http://pritch.bsd.uchicago.edu/software.html), uses a multi-
stage approach that first identifies any subpopulations using unlinked
markers, assigns individuals to putative subpopulations, and then uses
subpopulation clusters as a covariate in tests for association with disease
phenotype. The STRUCTURE method is extremely computationally
demanding. One assumption that we need to make for the STRUCTURE
analysis is the number of potential subpopulations in the dataset. Under
the given K subpopulations, detected the probability of the membership
within each subpopulation is estimated. Therefore, results may be differ-
ent for a different given number of K, and a STRUCTURE analysis may
need to be run a few times to tune the K parameter.
Reich et al.
29
proposed a feasible computational approach to detect and
correct population stratification. In their approach, PCA is used to model
ancestry difference between case and control. The EIGENSTRAT approach
identifies ancestry differences among samples along eigenvectors of a
covariates matrix. For instance, Fig. 1 depicts the relationship among the
first three principle components (PC1, PC2, and PC3) in SCORM dataset,
which implies five outliers to be excluded from further association analyses.
In addition to excluding these samples, the EIGENSTRAT approach is to
adjust the amounts attributable to ancestry for the top eigenvectors
(http://genepath.med.harvard.edu/~reich/Software.htm). Patterson et al.
30
pointed out that top eigenvectors could be caused by a large set of mark-
ers in a high (or complete) LD block. Hence, they recommend pruning the
markers in tight LD before performing PCA.
Association Tests
As association studies have dominated human genetics in the past decade,
many association methods (family-based or case-control based) have
been developed (e.g. Refs. 31–33). The analysis strategies for GWA data
are generally the same as those for candidate gene association studies,
222 Y.J. Li and Q. Fan
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 222
determined by the study design and the type of phenotypes to be tested.
However, new challenges are forthcoming as well due to the large amount
of data derived from a GWA study. One key consideration is whether
one can perform efficient association analysis in a reasonable timeframe.
A few free and commercial computer programs, such as PLINK (http://
pngu.mgh.harvard.edu/~purcell/plink/), Golden Helix (http://www.
helixtree.com/index.html), and Syllego (http://www.rosettabio.com/
products/syllego) were, therefore, developed for processing genome wide
SNP data, including data management and analyses.
PLINK, in particular, a whole genome association analysis tool set, is a
popular and widely used free program, which has evolved fast not just to
handle genome wide SNP data but also CNV data. A series of modules for
data management, quality control checks, population stratification, asso-
ciation analysis, etc, are implemented in PLINK. Most importantly, PLINK
decodes pedigree file (pedigree and genotype information) to the binary
format, which significantly decreases the computational time for a genome
wide scan and makes PLINK an efficient tool for GWA studies.
223 Statistical Analysis of Genome-wide Association Studies for Myopia
Figure 1. The first three principle components (PC1, PC2, and PC3) in SCORM dataset.
−0.15 −0.10 −0.05 0.00 0.05 0.10

0
.
1
5

0
.
1
0

0
.
0
5
0
.
0
0
0
.
0
5
0
.
1
0
PC1 vs. PC2
eigenvector 1
e
i
g
e
n
v
e
c
t
o
r

2
−0.15 −0.10 −0.05 0.00 0.05 0.10

0
.
5
0
.
0
0
.
5
PC1 vs. PC3
eigenvector 1
e
i
g
e
n
v
e
c
t
o
r

3
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 223
Depending on the phenotype and hypothesis to be tested, different
association methods can be applied. For unrelated population-based
samples, Fisher exact test, Cochran–Armitage trend test, and logistic
regression are commonly used for qualitative traits, and the linear
model is used for quantitative traits. All these methods have been imple-
mented in PLINK. Both logistic regression and the linear model have the
flexibility of incorporating covariates that may have confounding effects
to the phenotype.
For family-based data, since the development of the TDT method,
31
many extensions of TDT methods or new family-based association meth-
ods and computer programs were developed, including PDT,
32
FBAT,
34
APL,
35
QTDT,
36–40
just to name a few. Although these computer programs
with family-based association tests have been used extensively in associa-
tion studies, computational time is a concern for the GWA setting.
While PLINK is an efficient tool, the family-based association methods
implemented in PLINK are limited to TDT, parent-TDT, and parent-of-
origin using parent-offspring triad dataset for qualitative traits, and Qfam
for quantitative traits. Qfam is an ad hoc procedure analogous to the
between/within orthogonal model proposed by Fulker et al.
39
and Abecasis
et al.
40
that was implemented in the QTDT package (http://www.sph.
umich.edu/csg/abecasis/QTDT/), with some modifications by using
permutation procedure to infer familial relationship (see PLINK website).
For a GWA dataset using family other than triads (e.g. discordant sib-
pairs or nuclear families of multiple siblings with or without parents),
one will need to seek out the existing family-based association programs.
Regardless what association methods and programs are chosen, it is
important to perform proper association tests with proper statistical
methods. One should judge their own dataset to determine the data
analysis strategies.
Association tests are generally performed for a single marker at a time or
haplotypes of multiple markers within a feasible window size. So far, most
GWA studies focus on single marker association tests first. The computa-
tional time and strategy of performing haplotypes association tests are
the main concern for the genome-wide haplotype analysis, even though
haplotypes association methods and programs have been developed exten-
sively in the past (e.g. Haplo.stat, APL, etc).
33,41
The use of sliding windows
with a fixed window size is a popular approach, but it does not capture the
joint effect of distantly located SNPs. One common practice is to conduct
single locus association analyses first to identify target regions (or genes)
224 Y.J. Li and Q. Fan
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 224
and then follow-up with haplotype association analyses. It is clear that
we may miss the haplotypes that do not show single locus main effect
but joint effects from multiple loci to the target phenotype.
Correlated Phenotypes
Although myopia is clinically determined by refractive errors, as men-
tioned before, other ocular biometrics also play a role in the development
of myopia. Therefore, these ocular biometric are correlated in a certain
degree. For instance, in Table 2, we show the squared Pearson correlation
coefficient (r
2
) for all pairs of SPH, SE, axial length, and cornea curvature
based on the right eye data using data from Chinese participants in
SCORM study. The correlation among SPH, SE, and axial length are
indeed strong (r
2
> 0.56), in which axial length is negatively correlated
with SPH and SE. Axial length is correlated at some degree with cornea
curvature (r
2
= 0.17) and anterior chamber depth (r
2
= 0.19). If GWA
analyses are conducted for these endophentoypes of myopia, an immedi-
ately question will be whether one should correct multiple testing based
on the number of traits tested on top of the number of markers in the
panel. This is an open question without an absolute answer. Our view is
that if the traits are highly correlated, we do not consider the needs for cor-
recting multiple testing for the number of traits tested since they are
equivalent to a single trait.
Another aspect of myopia-related phenotypes is that each biometric is
measured for the right and left eye, respectively. Should one analyze
data from each eye individually or a summary form of both eyes such as
the average? Certainly, the results will vary depending on the degree of the
225 Statistical Analysis of Genome-wide Association Studies for Myopia
Table 2. Pairwise Squared Pearson Correlation Coefficient (r
2
) Across Four Ocular
Biometrics
Anterior
Sphere Axial Cornea Chamber
Sphere Equivalent Length Curvature Depth
Sphere 1 0.98 0.56 0.01 0.05
Sphere equivalent 1.00 0.57 0.02 0.05
Axial length 1.00 0.17 0.19
Cornea curvature 0.00 1.00 0.00
Anterior chamber depth 1
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 225
similarity between the measures of both eyes for these approaches. Apart
from analyzing single phenotype at a time, there are statistical methods
available for analyzing correlated data jointly. For instance, generalized
equation (GEE) can take into account correlation within the same strata
(same individual in this case), which can serve as an alternative approach.
Here, we utilize the GWA data from SCORM to illustrate the association
results (−log 10(p-value)) in a region (from 23,555,218 to 24,149,104 bp)
of chromosome 11 MYP7 locus using GEE analysis for SE from both
eyes, and linear model analyses for SE from the right eye and left eye,
respectively, and the average of SE of both eyes. This analysis shows that
both GEE and linear model analysis for the average SE revealed interme-
diate results between those obtained from the right and left eye, respec-
tively, for almost all markers tested (Fig. 2). Although in this example the
226 Y.J. Li and Q. Fan
Figure 2. Association results (−log 10(p-values)) of the linear model analysis using SE of right and
left eye, respectively, and the average SE of both eyes from linear model analysis, and GEE
analysis using SE from both eyes.
23600000 23700000 23800000 23900000 24000000 24100000
0
1
2
3
4
5
basepair position

l
o
g
1
0
(
p

v
a
l
u
e
)
right eye
left eye
GEE
average
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 226
use of average SE from both eyes seems to provide better p-values (smallest
p-values) for the top-hit marker than GEE, this does not dismiss the GEE
analysis until more formal evaluation is done. The fact that GEE or the
analysis on the average SE from both eyes support the top finding from the
right or left eye will enhance the credibility of the conclusion for the study.
Imputation and Meta-Analysis
Under the phenomenon of common variants of common diseases, most
susceptibility variants have small to moderate genetic effects to the disease.
Therefore, without a large sample size, it is hard to detect true positive
results in a single association study, which is often constrained by the
budget and sample resources.
42
Meta-analysis, by combining evidence from
comparable independent association studies, thus provides a robust
approach to enhance statistics power and effective sample size.
43,44
Application of meta-analysis in GWAS society is becoming a standard
practice recently to identify loci related to the risk of disease, exemplified
by studies for diabetes, Alzheimer, bipolar disorder, etc.
45–47
Prior to meta-analysis, as described earlier, one should ensure that the
phenotypes are comparable and were measured in similar ways across
datasets. In addition, due to the rapid changes of SNP chips, different
studies may utilize different versions of SNP chips with different coverage
of SNP content. That is, not all SNPs were typed consistently across stud-
ies. The development of several imputation methods for inferring geno-
types of untyped markers has provided a solution for this problem. The
basic idea behind imputation is to utilize the correlation among untyped
and typed markers to infer the genotypes of untyped markers in each
dataset.
48
This correlation mostly relies on the information obtained from
the reference panel that has genotypes of both untyped and typed mark-
ers. With the availability of more than three million genotype data from
the International HapMap Project, most non-overlapping SNPs between
SNP chips can now be inferred. It should be noted that imputation is
generally computational intensive. IMPUT,
49
MACH,
50
BEAGLE,
51
and
BIMBAM
52
are the frequently used programs for imputation. Each of
them has different strengths and weaknesses, but none of them is optimal
for all situations.
48,53
Nonetheless, with these imputation programs becom-
ing available, we now can impute untyped markers at the first stage to
allow assessing multiple datasets for the same set of SNPs.
49
227 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 227
Meta-analysis in the setting of genetic studies refers to combining sum-
mary statistics of overlapping SNPs from multiple genetic association
studies. Since combining raw individual genotype and phenotype data
across studies to perform pooled analysis is in general difficult, the meta-
analysis is a reasonable surrogate to assess the association results across all
datasets. Here, we describe a few meta-analysis methods.
First, the simplest meta-analysis method is Fisher’s methods
T
fisher
= –2∗Σlog(p
i
), where p
i
is p value of study I, i = 1,…,k. T
fisher
follows a χ
2
distribution of 2k degrees of freedom, where k is the total
number of datasets. Since Fisher’s method takes only information from
the p-values, it is important to keep in mind that Fisher’s method should
be applied to the markers with the same direction of the effect to the sus-
ceptibility of the disease. Second, Mantel–Haenszel methods are com-
monly used for dichotomous traits if the information on 2 × 2 table can
be recoverable from each study.
54
In combining the odds ratio, weight is
usually given proportionally to the precision of its results in each study.
Finally, if a 2 × 2 table is not available in each study, such as if p values were
obtained from logistical regression framework in order to adjust for poten-
tial confounding covariates, using z-score statistics to compute the meta-p
values is the best. Z-score statistics are wildly used in practice for meta-
analysis since Z-score could be easily converted in each study and the direc-
tion of effect is manifested in itself.
55
Combined z-score is calculated as:
Z
meta
= Σz
i
xw
i
, where z
i
is the z-score from study i and w
i
is the weight of
study i. Once pooled z score is obtained, the corresponding p values for the
combined studies can be computed as well. Most widely used weights are
the inverse of the variance of the effect estimate for each study. The pooled
inverse variance-weighted z-score is calculated as the sum of individual
z score using inverse variance as weight. In case the variance is not given in
the summary statistics or standard error, SE in the equation below, is not
on the same unit (for example, the quantitative trait is not measure on the
same unit), z score can then be summed across multiple studies weighting
them by study sample size
It is unlikely that every dataset for a meta-analysis is derived from a single
homogenous population with the same genetic effect. Therefore, it
is important to access the heterogeneity across datasets. Random effects,
Z
SE
w w
i i
N
N
i
meta
i
i
= where
total
b

× = .
228 Y.J. Li and Q. Fan
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 228
assuming true effect differs among studies, consider two sources of
variances: within-study sampling error and between-study heterogeneity.
The commonly used method to test between-study heterogeneity is called
Cochran’s Q statistics, for which the large values of Cochran’s Q favor the
alternative hypothesis of heterogeneity.
56
For datasets i = 1, …,k, T
1
, …,T
k
is the study-specific effect size. The Cochram’s Q statistic is computed by
and w
i
is the inverse of the estimated variance in dataset i. Q is distributed
as a chi-square distribution with k-1 degree of freedom. An alternative
form, statistic I
2
(inconsistency), derived from Q, 100% × (Q-degree of
freedom), is a measure of the percentage of heterogeneity vs total variation
across studies. If I
2
> 50%, it indicates the presence of heterogeneity. If evi-
dence of heterogeneity is demonstrated, measure to identify its possible
cause is needed before any explicit conclusion is drawn. In such a case,
additional cohort for replication or fine mapping approaches might be
required to further investigate on the true genetic variants of interest.
Visualization Tools
To synthesize hundreds of thousands of p-values for multiple phenotypes
from a GWA study, it often relies on good graphical presentation.
Manhattan plots and Quantile-Quantil (Q-Q) plots are the most fre-
quently used figures to present p-values of high density markers across the
whole genome. Manhattan plot can be easily generated from Haploview
program (hapmap.org), and can provide an overall view of the association
evidences in the nearby region of the highly significant variants. Here, we
show an example of Manhattan plot using the GWA results for SE from
right eye from the SCORM GWA studies of Chinese children (Fig. 3). This
figure provides snapshots on the chromosomal regions with promising
association evidence. For instance, a region in chromosome 13 revealed
the best p-value.
Q-Q plots provide a visual summary of the distribution of the observed
test statistics (e.g. chi-square test statistic) in the GWA study vs the
expected statistic. McCarthy et al. (2008)
16
provided a nice illustration of
Q-Q plots with interpretation of the pattern (see Box 2 in McCarthy et al.).
Q w T T T
wT
w
i
i
k
i
k
i
i
k
i
= − =
=
=
=

( ),
1
1
1 1
1
where
Σ
Σ
229 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 229
For instance, when the Q-Q plot line is close to the diagonal line, it indi-
cates that there is very little association evidence in the study. One the
other hand, if the observed line is much off from the diagonal line, there
may be concerns for the population stratification. If only the tail part of
the Q-Q plot line is much off from the diagonal line, it indicates that there
is compelling evidence of the disease association in the dataset.
Both Manhattan and Q-Q plots are tools for summarizing all p-values
from GWA studies, not providing additional bioinformation related to the
SNP. WGAviewer, another free program, can annotate the SNPs and their
associated p-values in relationship to gene structure, SNP function, gene
expression, and other GWA studies (http://www.genome.duke.edu/centers/
pg2/downloads/wgaviewer.php).
57
This tool can take us beyond p-values
by providing biological information for the loci of interest.
Drawing Conclusions
To date, the determination of ‘top-hit’ markers in the GWA setting is
mostly p-value driven. The threshold for declaring genome wide signifi-
cance is widely accepted at 5 × 10
–8
.
1,58,59
However, sample size should
be considered even though such a p-value is reached. Regardless what top
p-values are observed in the GWA study, it will need to be replicated
by other independent datasets. In addition, to judge the p-values from
GWA studies, prior genetic research findings can also serve as good
references. The genetic research of myopia has a great resource of linkage
230 Y.J. Li and Q. Fan
Figure 3. An overview of GWA results for the SE trait (left eye) from the SCORM and SP datasets,
respectively.
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 230
information (e.g. MYP loci) and public expression data, such as EyeSAGE
database
60
from human retina and retinal pigment epithelium. This infor-
mation can definitely help investigators to prioritize the GWA results.
Acknowledgments
The grant 06/1/21/19/466 from the Singapore BioMedical Research
Council (BMRC) and National Institutes of Health grant 1R21-EY-019086
provided funding for the genome wide association study for SCORM.
References
1. Risch N, Merikangas K. (1996) The future of genetic studies of complex
human disorders. Science 273(5281): 1516–1517.
2. Wellcome Trust Case Control Consortium. (2007) Genome-wide association
study of 14,000 cases of seven common diseases and 3,000 shared controls.
Nature 447(7145): 661–678.
3. Nakanishi H, Yamada R, Gotoh N, et al. (2009) A genome-wide association
analysis identified a novel susceptible locus for pathological myopia at
11q24.1. PLoS Genet 5(9): e1000660.
4. Schwartz M, Haim M, Skarsholm D. (1990) X-linked myopia: Bornholm eye
disease. Linkage to DNA markers on the distal part of Xq. Clin Genet 38(4):
281–286.
5. Young TL, Ronan SM, Alvear AB, et al. (1998) A second locus for familial high
myopia maps to chromosome 12q. Am J Hum Genet 63(5): 1419–1424.
6. Young TL, Ronan SM, Drahozal LA, et al. (1998) Evidence that a locus for
familial high myopia maps to chromosome 18p. Am J Hum Genet 63(1):
109–119.
7. Paluru P, Ronan SM, Heon E, et al. (2003) New locus for autosomal dominant
high myopia maps to the long arm of chromosome 17. Invest Ophthalmol Vis
Sci 44(5): 1830–1836.
8. Paluru PC, Nallasamy S, Devoto M, et al. (2005) Identification of a novel locus
on 2q for autosomal dominant high-grade myopia. Invest Ophthalmol Vis Sci
46(7): 2300–2307.
9. Zhang Q, Guo X, Xiao X, et al. (2005) A new locus for autosomal dominant
high myopia maps to 4q22-q27 between D4S1578 and D4S1612. Mol Vis 11:
554–560.
10. Zhang Q, Guo X, Xiao X, et al. (2006) Novel locus for X linked recessive high
myopia maps to Xq23-q25 but outside MYP1. J Med Genet 43(5): e20.
231 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 231
11. Nallasamy S, Paluru PC, Devoto M, et al. (2007) Genetic linkage study of
high-grade myopia in a Hutterite population from South Dakota. Mol Vis 13:
229–236.
12. Lam CY, Tam PO, Fan DS, et al. (2008) A Genome-wide Scan Maps a Novel
High Myopia Locus to 5p15. Invest Ophthalmol Vis Sci 49(9): 3768–3778.
13. Barrett JC, Hansoul S, Nicolae DL, et al. (2008) Genome-wide association
defines more than 30 distinct susceptibility loci for Crohn’s disease. Nat Genet
40(8): 955–962.
14. Ciner E, Wojciechowski R, Ibay G, et al. (2008) Genomewide scan of ocular
refraction in African-American families shows significant linkage to chromo-
some 7p15. Genet Epidemiol 32(5): 454–463.
15. Klein AP, Suktitipat B, Duggal P, et al. (2009) Heritability analysis of spherical
equivalent, axial length, corneal curvature, and anterior chamber depth in the
Beaver Dam Eye Study. Arch Ophthalmol 127(5): 649–655.
16. McCarthy MI, Abecasis GR, Cardon LR, et al. (2008) Genome-wide associa-
tion studies for complex traits: consensus, uncertainty and challenges. Nat
Rev Genet 9(5): 356–369.
17. Devlin B, Roeder K. (1999) Genomic control for association studies.
Biometrics 55(4): 997–1004.
18. Pritchard JK, Stephens M, Rosenberg NA, Donnelly P. (2000) Association
mapping in structured populations. Am J Hum Genet 67: 170–181.
19. Price AL, Patterson NJ, Plenge RM, et al. (2006) Principal components analy-
sis corrects for stratification in genome-wide association studies. Nat Genet
38(8): 904–909.
20. Skol AD, Scott LJ, Abecasis GR, Boehnke M. (2007) Optimal designs for two-
stage genome-wide association studies. Genet Epidemiol 31(7): 776–788.
21. Wang H, Thomas DC, Pe’er I, Stram DO. (2006) Optimal two-stage geno-
typing designs for genome-wide association scans. Genet Epidemiol 30(4):
356–368.
22. Muller HH, Pahl R, Schafer H. (2007) Including sampling and phenotyping
costs into the optimization of two stage designs for genomewide association
studies. Genet Epidemiol 31(8): 844–852.
23. Barrett JC, Cardon LR (2006) Evaluating coverage of genome-wide associa-
tion studies. Nat Genet 38(6): 659–662.
24. (2004) Finishing the euchromatic sequence of the human genome. Nature
431(7011): 931–945.
25. Li M, Li C, Guan W. (2008) Evaluation of coverage variation of SNP chips for
genome-wide association studies. Eur J Hum Genet 16(5): 635–643.
26. Fellay J, Shianna KV, Ge D, et al. (2007) A whole-genome association study of
major determinants for host control of HIV-1. Science 317(5840): 944–947.
232 Y.J. Li and Q. Fan
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 232
27. Pritchard JK, Donnelly P (2001) Case-control studies of association in struc-
tured or admixed populations. Theor Popul Biol 60(3): 227–237.
28. Bacanu SA, Devlin B, Roeder K. (2000) The power of genomic control. Am J
Hum Genet 66(6): 1933–1944.
29. Reich M, Liefeld T, Gould J, et al. (2006) GenePattern 2.0. Nat Genet 38(5):
500–501.
30. Patterson N, Price AL, Reich D. (2006) Population Structure and Eigenanalysis.
PLoS Genet 2(12): e190.
31. Spielman RS, Ewens WJ. (1996) The TDT and other family-based tests for
linkage disequilibrium and association. Am J Hum Genet 59(5): 983–989.
32. Martin ER, Monks SA, Warren LL, Kaplan NL. (2000) A test for linkage and
association in general pedigrees: the pedigree disequilibrium test. Am J Hum
Genet 67: 146–154.
33. Schaid DJ, Rowland CM, Tines DE, et al. (2002) Score tests for association
between traits and haplotypes when linkage phase is ambiguous. Am J Hum
Genet 70(2): 425–434.
34. Rabinowitz D, Laird N. (2000) A unified approach to adjusting association
tests for population admixture with arbitrary pedigree structure and arbitrary
missing marker information. Hum Hered 50: 211–223.
35. Martin ER, Bass MP, Hauser ER, Kaplan NL. (2003) Accounting for linkage in
family-based tests of association with missing parental genotypes. Am J Hum
Genet 73(5): 1016–1026.
36. Allison DB. (1997) Transmission-disequilibrium tests for quantitative traits.
Am J Hum Genet 60: 676–690.
37. Rabinowitz D. (1997) A transmission disequilibrium test for quantitative trait
loci. Hum Hered 47: 342–350.
38. Monks SA, Kaplan NL. (2000) Removing the sampling restrictions from
family-based tests of association for a quantitative-trait locus. Am J Hum
Genet 66(2): 576–592.
39. Fulker DW, Cherny SS, Sham PC, Hewitt JK. (1999) Combined linkage and
association sib-pair analysis for quantitative traits. Am J Hum Genet 64(1):
259–267.
40. Abecasis GR, Cardon LR, Cookson WO. (2000) A general test of association
for quantitative traits in nuclear families. Am J Hum Genet 66(1): 279–292.
41. Chung RH, Hauser ER, Martin ER. (2006) The APL test: extension to general
nuclear families and haplotypes and examination of its robustness. Hum
Hered 61(4): 189–199.
42. Lohmueller KE, Pearce CL, Pike M, et al. (2003) Meta-analysis of genetic asso-
ciation studies supports a contribution of common variants to susceptibility
to common disease. Nat Genet 33(2): 177–182.
233 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 233
43. Lau J, Ioannidis JP, Schmid CH. (1997) Quantitative synthesis in systematic
reviews. Ann Intern Med 127(9): 820–826.
44. Munafo MR, Flint J. (2004) Meta-analysis of genetic association studies.
Trends Genet. 20(9): 439–444.
45. Zeggini E, Scott LJ, Saxena R, et al. (2008) Meta-analysis of genome-wide
association data and large-scale replication identifies additional susceptibility
loci for type 2 diabetes. Nat Genet 40(5): 638–645.
46. Bertram L, McQueen MB, Mullin K, et al. (2007) Systematic meta-analyses of
Alzheimer disease genetic association studies: the AlzGene database. Nat
Genet 39(1): 17–23.
47. Baum AE, Hamshere M, Green E, et al. (2008) Meta-analysis of two genome-
wide association studies of bipolar disorder reveals important points of
agreement. Mol Psychiatry 13(5): 466–467.
48. Guan Y, Stephens M. (2008) Practical issues in imputation-based association
mapping. PLoS Genet 4(12): e1000279.
49. Marchini J, Howie B, Myers S, et al. (2007) A new multipoint method for
genome-wide association studies by imputation of genotypes. Nat Genet
39(7): 906–913.
50. Li Y, Abecasis GR. (2006) Mach 1.0: Rapid Haplotype Reconstruction and
Missing Genotype Inference. Am J Hum Genet S79: 2290.
51. Browning SR, Browning BL. (2007) Rapid and accurate haplotype phasing
and missing-data inference for whole-genome association studies by use of
localized haplotype clustering. Am J Hum Genet 81(5): 1084–1097.
52. Servin B, Stephens M. (2007) Imputation-based analysis of association
studies: candidate regions and quantitative traits. PLoS Genet 3(7): e114.
53. Ellinghaus D, Schreiber S, Franke A, Nothnagel M. (2009) Current software
for genotype imputation. Hum Genomics 3(4): 371–380.
54. Mantel N, Haenszel W. (1959) Statistical aspects of the analysis of data from
retrospective studies of disease. J Natl Cancer Inst 22(4): 719–748.
55. de Bakker PI, Ferreira MA, Jia X, et al. (2008) Practical aspects of imputation-
driven meta-analysis of genome-wide association studies. Hum Mol Genet
17(R2): R122–R128.
56. Cochran WG. (1954) The combination of estimates from different experi-
ments. Biometrics 10: 101–129.
57. Ge D, Zhang K, Need AC, et al. (2008) WGAViewer: software for genomic
annotation of whole genome association studies. Genome Res 18(4): 640–643.
58. International HapMap Consortium. (2005) A haplotype map of the human
genome. Nature 437(7063): 1299–1320.
59. Hoggart CJ, Clark TG, De IM, et al. (2008) Genome-wide significance for
dense SNP and resequencing data. Genet Epidemiol 32(2): 179–185.
234 Y.J. Li and Q. Fan
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 234
60. Bowes Rickman C, Ebright JN, Zavodni ZJ, et al. (2006) Defining the human
macula transcriptome and candidate retinal disease genes using EyeSAGE.
Invest Ophthalmol Vis Sci 47(6): 2305–2316.
61. Young TL. (2009) Molecular genetics of human myopia: an update. Optom
Vis Sci 86(1): E8–E22.
62. Klein R, Klein BE, Tomany SC, Cruickshanks KJ. (2003) The association of
cardiovascular disease with the long-term incidence of age-related maculopa-
thy: the Beaver Dam Eye Study. Ophthalmology 110(6): 1273–1280.
63. Metlapally R, Li YJ, Tran-Viet KN, et al. (2009) COL1A1, COL2A1 Genes and
Myopia Susceptibility: evidence of Association and Suggestive Linkage to the
COL2A1 Locus. Invest Ophthalmol Vis Sci.
64. Pertile KK, Schache M, Islam FM, et al. (2008) Assessment of TGIF as a can-
didate gene for myopia. Invest Ophthalmol Vis Sci 49(1): 49–54.
65. Mutti DO, Hayes JR, Mitchell GL, et al. (2007) Refractive error, axial length,
and relative peripheral refractive error before and after the onset of myopia.
Invest Ophthalmol Vis Sci 48(6): 2510–2519.
66. Stambolian D, Ibay G, Reider L, et al. (2004) Genomewide linkage scan for
myopia susceptibility loci among Ashkenazi Jewish families shows evidence of
linkage on chromosome 22q12. Am J Hum Genet 75(3): 448–459.
67. Ibay G, Doan B, Reider L, et al. (2004) Candidate high myopia loci on chro-
mosomes 18p and 12q do not play a major role in susceptibility to common
myopia. BMC Med Genet 5: 20.
68. Heath S, Robledo R, Beggs W, et al. (2001) A novel approach to search for
identity by descent in small samples of patients and controls from the same
mendelian breeding unit: a pilot study on myopia. Hum Hered 52(4):
183–190.
69. Yanovitch T, Li YJ, Metlapally R, et al.(2009) Hepatocyte growth factor and
myopia: genetic association analyses in a Caucasian population. Mol Vis 15:
1028–1035.
70. Han W, Leung KH, Fung WY, et al. (2009) Association of PAX6 polymor-
phisms with high myopia in Han Chinese nuclear families. Invest Ophthalmol
Vis Sci 50(1): 47–56.
71. Liang CL, Hung KS, Tsai YY, et al. (2007) Systematic assessment of the tagging
polymorphisms of the COL1A1 gene for high myopia. J Hum Genet 52(4):
374–377.
235 Statistical Analysis of Genome-wide Association Studies for Myopia
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 235
b846_Chapter-3.4.qxd 4/8/2010 2:00 AM Page 236
This page intentionally left blank This page intentionally left blank
Animal Models and
the Biological Basis of Myopia
Section 4
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 238
This page intentionally left blank This page intentionally left blank
The Relevance of Studies in Chicks for
Understanding Myopia in Humans
Josh Wallman*
,‡
and Debora L. Nickla

Introduction
Research on the etiology of myopia can be divided into the periods before
and after animal research into myopia became prominent. During the
earlier period, the predominant opinions were that myopia was either
entirely of genetic origin (although there was no strong genetic evidence),
or that it was entirely due to excess accommodation (with no plausible evi-
dence linking accommodation to myopia). In addition, a few eccentrics
held that myopia was a homeostatic response to a habitual near-viewing
distance.
The accidental discovery during the 1970’s that obscuring the view of
the eye of a monkey, chick, tree shrew, or child made the eye myopic
demanded an explanation of how visual experience altered the eye or
brain.
1–4
Subsequently, this was shown to be true for mice as well.
5,6
The
most important discovery that followed, showing that eyes would alter
their refractive state, compensating for either negative or positive specta-
cle lenses, in chickens, fish, tree shrews, marmosets, rhesus monkeys, and
guinea pigs,
7–12
made it inescapable that there existed a homeostatic mech-
anism that regulated refractive error. This homeostatic mechanism posed
the difficult problem that it required that the eye or brain be able to
distinguish hyperopic defocus (image behind the photoreceptors) from
myopic defocus (image in front of the photoreceptors). Here, human
239
4.1
*City College, City University of New York, New York.

New England College of Optometry, Boston, Massachusetts.

Corresponding author. Department of Biology, City College, CUNY, 160 Convent Ave., New York,
NY 10031. E-mail: [email protected]
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 239
intuition fails us. We are only able to focus a microscope or binoculars by
trial and error, recalling whether the image is more in focus than it was a
fraction of a second earlier; it seems impossible that the eye could use this
method, especially as it seems implausible that the eye or brain could recall
how sharp an image was days or months before — the time required for
eye-growth to cause a detectible change in refractive status. Therefore,
the visual system would seem to do better automatically than we can do
consciously.
These discoveries from experiments on animals have had a curiously
ambivalent effect on clinical research on myopia. On the one hand, it has
made the entire community very attuned to the possible consequences of
blur. Thus, there have been dozens, if not hundreds, of papers evaluating
the possibility that blur caused by inadequate accommodation or higher
order optical aberrations or transient myopia after long periods of reading
might cause myopia. Furthermore, there has been a major, meticulously
conducted clinical trial using progressive addition lenses on children to
reduce the magnitude of the defocus experienced.
13
On the other hand, the
most important insight of the animal research — that there was a bidirec-
tional homeostatic control of refractive state — has been largely ignored
in the clinical community, so that only occasional studies
14
have tested the
notion that the way to counteract the effects of hyperopic blur leading to
myopia is not with less hyperopic blur but with myopic blur, which may
lead the eye away from myopia.
It was an accident that proved fortunate for the development of mod-
ern biology that Gregor Mendel studied the particular traits of peas that
he did, and thereby discovered the simplest form of inheritance. One won-
ders how many other monks chose to study drought-resistance or plant-
height or animal-size and failed to find a tractable experimental system.
Similarly, the choice of the mold Neurospora and the fly Drosophila were
fortunate choices for the study of genetics and of circadian rhythms, as
were the choices of the roundworm C. elegans for cell-lineage studies and
of zebra fish for developmental studies. One presumes that none of these
fields would be where they are today had the researchers chosen cats or
chimpanzees.
In myopia research, the accidental choice of chicks and monkeys dur-
ing the 1970’s, resulting from unrelated studies on effects of experience
on brain development, have proven particularly fortunate. Because
this volume is largely devoted to studies of myopia in humans and
because we were asked to write on “The Pivotal Role of the Chick Eye,” we
240 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 240
will concentrate on aspects of myopia research on chicks that bear on
clinical concerns.
The Search for Error Signals
The existence of a homeostatic mechanism that guides the eye towards
emmetropia requires one or more error signals that reflect how far the eye
is from its “goal” or set-point. Thus, to consider what the possible visual
error signals guiding eye growth might be rests on whether or not the eyes
can discern the sign of defocus, instead of simply the degree of defocus. If
the eye can only use the degree of defocus, many possible visual signals,
such as the absence of small features in the environment (high spatial fre-
quencies) might provide that information. Indeed, the issue becomes sim-
ilar to the psychophysical question of how we can assess that an image is
blurred. One could imagine that one simply assesses the amount of visual
stimulation, which would be higher in focused images; or perhaps one
measures the activity of neurons responsive to high spatial frequencies,
which would also be higher in focused images. In the perceptual case, one
can dismiss both of these possibilities, because clouds, for example, which
contain neither strong contrasts nor high spatial frequencies, do not
appear blurred. Instead, two psychophysical theories are in contention at
present. One holds that the visual system compares the activity of neurons
tuned to higher and lower spatial frequencies, that is, it estimates the slope
of the function of “power” versus spatial frequency.
15
The other holds
that the visual system performs a template match of the edges at different
spatial frequencies.
16
The blur hypothesis
In the case of eye-growth, one could argue that the eye simply elongates
in proportion to the amount of blur that elongation is inhibited propor-
tionally by retinal activity (the Blur Hypothesis). This view would equate
the myopia caused by wearing negative lenses with that caused by form-
deprivation, and it would explain why increasing retinal activity by
intense stroboscopic illumination prevents myopia induced by form-dep-
rivation and drives eyes toward hyperopia.
According to this view, blur could provide the error-signal guidance for
people or animals that mostly view distant objects, assuming that neonates
241 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 241
were hyperopic and accommodation imperfect, so that the amount of
visual detail, and hence the magnitude of visual neural activity, would be
low at first and would increase until the eye became emmetropic. This
hypothesis would not explain how myopic neonates would emmetropize;
instead, it would predict that they would become progressively more
myopic. Furthermore, to explain the compensation for positive lenses, this
hypothesis would require that neonates mostly view nearby objects, so that
the positive lenses would bring most objects into focus, thereby increasing
the activity of retinal neurons, and as a result, inhibiting ocular elongation.
This conjecture brings on a larger problem: Why would not all young eyes
become myopic, thereby maximizing their retinal activity? Perhaps if
myopia caused all nearby objects to be in focus, the inhibition of ocular
elongation would be so strong that it would drive the eye back in the
hyperopic direction (as the cornea and lens continued to flatten), such that
only emmetropic eyes would have the level of blur that keeps the refractive
error stable. It is not obvious how this optimal level would be calibrated to
bring nearly all eyes close to emmetropia.
Bidirectional lens-compensation
The strongest challenge to the Blur Hypothesis is that at least some
animals compensating for defocus imposed by eyeglass lenses can appar-
ently compensate for both myopic and hyperopic defocus. To verify this
ability, one must be certain that the eyeglass lenses put on the animal do
impose opposite signs of defocus. This requires that the eye respond bi-
directionally to a level of defocus greater than its distance from
emmetropia. That is, if the eye is 5 D hyperopic and only responds to pos-
itive lenses of 4 D or less, one cannot test whether it truly responds to
myopic defocus.
In the case of chicks, their eyes clearly distinguish myopic defocus
(image in front of photoreceptors) from hyperopic defocus (image behind
photoreceptors). First, chicks, with or without accomodation, compen-
sate for positive lenses even if restrained from approaching the walls of
their chamber, which are placed beyond the far point of their eyes, ensur-
ing that all images are myopically defocused.
17,18
Second, when chicks are
wearing negative lenses, a few minutes a day of wearing positive lenses
negates the whole day of wearing negative lenses. It is difficult to imagine
that the sharp vision experienced in those few minutes increases the reti-
nal activity more than the sharp vision resulting from accommodation
242 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 242
over the course of the day. Third, covering positive lenses with a light dif-
fuser does not decrease the compensation for the positive lenses, even
though the same diffuser worn alone would cause myopia.
18
Fourth, if
eyes are enormously blurred by wearing lenses that are +5 D on one axis
and –5 D on the orthogonal axis (Jackson Crossed Cylinders), their
refractions go slightly in the hyperopic direction (the opposite of what
would be expected by the Blur Hypothesis and the opposite of what
occurs with light diffusers), and if weak positive or negative lenses are
added to the Jackson Crossed Cylinders, the eyes compensate normally
for these lenses.
19
The cases of marmosets and fish are similar to that of chicks: The refrac-
tions of marmoset eyes change reliably in the direction that compensates
for the lenses; because the eyes were emmetropic at the start of the experi-
ments, there is no issue of which side of emmetropia the lenses put
them.
20,21
In the case of fish, eyes wearing lenses that impose at least 9 D of
myopic defocus compensated by 7 D within the two-week observation
period, a change almost as great, but in the opposite direction as with
negative lenses.
10
In other species, the situation is more complicated. In guinea pigs and
tree shrews, only positive lenses of less than +4 D are compensated. In
guinea pigs, the eyes wearing positive lenses change in the opposite direc-
tion as those wearing negative lenses in refraction and ocular elongation,
but the eyes wearing positive lenses do not become more hyperopic than
the fellow eyes, because all lens-wear causes a small myopic shift in guinea
pigs.
12
However, the loss of directional compensation with the optic nerve
section
22
suggests that the intact animals may distinguish hyperopic from
myopic defocus. In tree shrews, the eyes also compensate for positive
lenses, but because the animals are +10 D hyperopic to begin with, the
positive lenses do not impose myopic defocus.
11
In monkeys, fitting eyes
with progressively increasing powers of negative or positive eyeglass lenses
causes eyes to become more myopic or hyperopic, respectively. Even very
strong positive lenses prevent the normal loss of hyperopia. Therefore, one
can say that the positive and negative lenses cause opposite responses. The
problem with this view is that the animals could look at very nearby
objects, so that even if the eyes could not discern the sign of defocus, the
occasional clear views might be enough to keep their refractions stable. To
address this concern, in a meticulous study, Norton et al. had tree shrews
wear positive lenses for 45 minutes once a day only when their viewing
distance was controlled and their accommodation monitored (wearing
243 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 243
negative lenses the rest of the time). Of those wearing +5 D lenses (but not
those wearing –5 D lenses), some animals grew in the hyperopic direction
and others in the myopic direction,
23
suggesting that at least some animals
were compensating for true myopic defocus.
Recovery from ametropia vs. compensation for lenses
Although the changes in eye-growth caused by lens-wear can only have a
visual origin, the same is not true for recovery from the myopia or hyper-
opia that results following lens-removal. Because the eye is abnormally
long or short, during recovery, the eye is not only compensating for the
myopia or hyperopia but is also restoring its natural shape. Thus, eye-
growth can be influenced by visual and shape-restoring mechanisms,
which can operate in the same or opposite directions, and they may inter-
act. For example, it requires less daily vision for chicks to recover from 10
D of myopia than for them to compensate for lenses imposing the same
defocus.
24
The relative potency of the visual and the shape-restoring mech-
anisms may vary among species, ages, and conditions. Thus, making eyes
myopic and then correcting the vision to emmetropia with lenses or put-
ting the animals in darkness can either keep the eyes myopic (if only vision
is at work) or can permit some recovery (if the shape-restoring mecha-
nism is stronger than the visual one) in both chicks
25,26
and tree shrews.
27
The complication of the emmetropization end-point
Another complication is that, although one tends to think of emmetropiza-
tion as a process that leads to emmetropia, probably guided by an esti-
mate of the refractive error, there is evidence from both monkeys and
chicks that the initial phase of emmetropization in neonates goes to a
stable refractive endpoint that is idiosyncratic for each individual, fol-
lowed much later by a second phase that goes to actual emmetropia.
28,29
The problem that this poses for studying lens-compensation in young
animals is that, if one does not know the end-point toward which an
animal’s eye is growing, one cannot be certain how to interpret the effect
of the eyeglass lens. For example, if an animal is +5 D hyperopic and if
the set-point the eye is growing towards is +2 D, imposing +3 D or less
of myopic defocus with positive lenses would have no effect, as the lenses
would simply help the eye towards its end-point, whereas if the set-point
had been more hyperopic or the lens-power stronger, it would have put
244 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 244
the eye beyond its set-point and made it grow in the hyperopic direction,
as one would expect for bidirectional lens-compensation. This individual
variation in set-points may account for why some tree shrews became
hyperopic and others myopic in the experiment described above in
which animals wore positive lenses briefly each day.
In this regard, the chick eye is most useful because it emmetropizes to
within a few diopters of emmetropia within a week of hatching and com-
pensates for lenses from –10 D to +15 D. Therefore, if one controls the
viewing distance and accommodation, one can be certain that the defocus
is hyperopic with negative lenses and myopic with positive lenses, and
therefore that this end-point complication does not apply.
Optical aberrations as error signals
The existence of bidirectional lens-compensation raises the question of
what error signal could provide the growth-guiding signal. In a perfect
optical system, one could not distinguish myopic from hyperopic defocus
unless one knew the object being imaged. However, real eyes are not per-
fect optical systems, and so the issue is what aberrations might provide the
signed error signal. Among the monochromatic aberrations (that is, the
ones that exist in monochromatic light), it is well known that spherical
aberration (the difference in focal length between the center and periph-
ery of the lens) can interact with defocus to give a signal that distinguishes
myopic from hyperopic defocus,
30
so that the focused image is not neces-
sarily the clearest.
31
This may be responsible for the finding in some
humans that the refractive error depends on the spatial frequency of the
stimuli viewed.
32
It may also account for the ability of humans to learn to
discriminate whether small letters are defocused in the myopic or hyper-
opic direction, when presented under carefully controlled conditions.
33
Arguing against the use of these aberrations is the fact that individual eyes
have different aberrations, and the visual system would seem to have to
know the aberrations of the particular eye to use them to distinguish the
sign of defocus.
A simpler error signal would make use of the longitudinal chromatic
aberration of the eye. Because short-wavelength (blue) light is focused
more strongly than long-wavelength (red) light, if a black/white edge is in
focus, the blue light will be focused in front of the photoreceptors, while
the red would be focused behind the photoreceptors. Thus, if the blue
aspect of the image were sharper than the red aspect, it would indicate that
245 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 245
the eye was defocused in the hyperopic direction (image focused behind
the photoreceptors), whereas if the red aspect were sharper, it would indi-
cate myopic defocus.
The interest in chromatic aberration as an error signal for
emmetropization and lens-compensation was diminished by studies some
years ago showing that chicks raised in monochromatic illumination
could compensate for lenses, although no comparison of wavelengths
could be made under these conditions. These findings do not imply that
chromatic aberration is not used, but only that other error signals can be
used. In fact, because chicks can compensate for as much as 10 D of defo-
cus imposed by eyeglass lenses,
34
the existence of other error signals is
implied because chromatic aberration would provide a useful error signal
only in the range of 1–3 diopters.
To make a stronger test of whether chromatic aberration is used, we
arranged to have chicks presented with wallpaper that simulated the chro-
matic contrasts that would be present at black/white edges if the eye were
myopic or hyperopic. We found clear evidence that the eye grew in the
direction that compensated for the simulated refractive error.
35
This result
shows that chromatic cues can be used to distinguish myopic from hyper-
opic defocus because no other cues were available from this simple striped
wallpaper.
Because there is credible evidence that humans use chromatic aberra-
tion to determine in which direction to accommodate,
36
it is plausible that
humans use chromatic aberration in emmetropization as well. The fact
that both chickens and humans have cones sensitive to blue, green, and red
light argues that chicks may, in this regard, be more similar to humans
than most mammals, which have only two cone-types.
Other possible visual error signals
The possible error signals are limited by the reader’s imagination, maybe
not even by that. The aberration of astigmatism results in light being
focused at two different planes, much like chromatic aberration. If the eye
knew the sign of its astigmatism, it could sense changes in the sign of
its defocus by a change in which lines were sharper. If the eye could com-
pare the image quality in the ventral visual field (which is myopic
37
) with
that in the central visual field, it could determine whether it was myopic or
hyperopic. If it could keep track of the changes in image quality
with accommodation, this too could yield the sign of defocus, as could
246 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 246
decoding the fluctuations in retinal position caused by oscillations in
blood flow or intraocular pressure. Unfortunately, none of these possible
signals have been put to a test.
One signal that has been put to a test is that the ON and OFF pathways
of the visual system seem differentially able to affect the compensation for
positive and negative lenses in chicks.
38
How Important is Having a Fovea?
One of the attributes of the chicken eye that makes many view it as an
inappropriate model for human myopia is the relatively uniform distribu-
tion of photoreceptors across the retina, in contrast to the steep gradient
of photoreceptor density as a function of retinal eccentricity in primates.
This uniformity helps make it believable that local parts of the retina can
adjust their own refractive state rather independently from other regions,
as shown by experiments with partial diffusers or with lenses covering part
of the retina.
39,40
Subsequently, it has been found that monkeys also adjust
the expansion of parts of the eye locally, very much like chicks.
41
The obvious importance of the fovea may be another instance in which
human intuition fails. Although our subjective awareness of the visual
world is dominated by what we see with the fovea, the foveal area is so
small that it contains few neurons. For example, although the parasol reti-
nal ganglion cells are 100 times more concentrated in the foveal region
than in the periphery, their total number increases with distance from the
fovea, simply because the retinal area increases. Indeed, there is no clear
evidence that the fovea has a privileged role in control of eye growth in
humans. It has been known since 1931 that individuals differ considerably
in the refractions of the peripheral retina
42
; furthermore, a longitudinal
study in 1971 showed that those adolescents with hyperopic refractions in
their peripheral retina were much more likely to become myopic than
those with myopic refractions in their peripheral retina.
43
It is an open
question whether peripheral hyperopia causes myopia, and, if it does,
whether it is because the hyperopia results from the eye compensating for
myopic defocus in the periphery or because the eye has an elongated shape
caused by myopia in the central retina.
44
One cannot overstate the importance of the finding, first in chickens
and then in primates, that the peripheral retina plays an important role in
experimental myopia. The implication of this role for human myopia is
247 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 247
threefold: First, it means that it may be futile to look for the etiology of
myopia in the small degrees of defocus that occur at the fovea, for exam-
ple during reading, when much larger degrees of defocus are present in the
periphery. Second, it forces one to accept that any particular point on the
retina will experience an alternation of myopic and hyperopic defocus
depending on whether the fovea (which largely controls accommodation)
is looking at an object closer or further than that particular peripheral
point. Third, it means that, as Ian Flitcroft has argued, when one is out-
doors the visual world is relatively flat in dioptric terms, in that nearly
everything is more than a meter away. Thus, no point on the retina would
be more than 1 diopter defocused relative to the point viewed with the
fovea. In contrast, the range of focal planes indoors is much greater so that
when viewing a nearby object like a book, the visual scene surrounding the
book can be several diopters defocused in the myopic direction, or, if one
focuses in the distance, the book can be several diopters defocused in the
hyperopic direction. This difference is likely to be more important than
the difference in light intensity between indoor and outdoor vision as a
factor in the etiology of myopia.
45
The awkward aspect of accepting the likely importance of peripheral
defocus in human myopia is that one cannot easily measure or control the
temporal pattern of defocus that would be experienced by each retinal
locus. In chickens, it is possible to begin to assess the effect of alternation
of myopic and hyperopic defocus by alternating strong positive and nega-
tive lenses. We found that, even though positive and negative lenses have
approximately equal effects when worn alone, the positive lenses have a
much greater effect than the negative lenses, when the lenses are alter-
nated.
46
Indeed, even a few minutes of positive lens-wear four times a day
can balance out the remainder of the day wearing negative lenses.
47
Furthermore, this asymmetry in the efficacy of the positive and negative
lenses depends on the frequency of alternation: if myopic and hyperopic
defocus is alternated several times a second, the asymmetry disappears.
48
To get to the mechanism underlying these alternation effects, we stud-
ied chicks with different periods of lens-wear alternating with different
periods of darkness. We found that periods of lens-wear less than two
minutes were without effect. Because chicks accommodate for only brief
periods, this may explain why accommodation seems to have little
effect on emmetropization or lens-compensation. Furthermore, we found
that there was a great difference in how long the intervals between lens-
wearing bouts could be before lens-compensation was lost: positive lenses
248 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 248
inhibited ocular elongation for much longer periods than negative lenses
stimulated it.
49
This probably explains the stronger effects of positive
lenses when they are alternated with negative lenses, but it does not
explain the similar effects of brief periods of positive and negative lenses
when worn alone. Although there are some temporal similarities among
the responses of chicks, tree shrews and monkeys,
50
it is likely that other
relevant temporal parameters may differ among species.
The implication of these complex timing effects is that one might be on
the wrong track by looking at the amount of time that children spend
reading as a risk-factor for myopia; the more important aspect may be the
particular temporal pattern with which a child alternates reading and
looking up from reading. Indeed, reading may itself involve an alternation
of myopic and hyperopic defocus both in the fovea and the periphery
because when a child looks up from reading he or she may experience a
transient near-work induced myopia.
51
Although of course we cannot
impose different temporal patterns of alternation of myopic and hyper-
opic defocus in children, we may be able to obtain clinically useful infor-
mation by studying the temporal pattern of reading shown by children
that become myopic compared with those who do not.
Mechanisms of Emmetropization
The two most prominent changes in the eye that contribute to
emmetropization and its laboratory analogue, eyeglass-lens compensa-
tion, are changes in ocular length (with associated scleral remodeling) and
changes in choroidal thickness. If the eye elongates more than usual or if
the choroid thins, the retina is pulled backward, making the eye more
myopic. Conversely, if the eye slows its elongation while the cornea and
lens continue to grow (thereby increasing their focal length), the eye will
become less myopic, as would occur if the choroid thickens. Wearing pos-
itive eyeglass lenses, which put the image in front of the photoreceptors,
causes the choroid to thicken and the ocular elongation to slow, both act-
ing to bring the image back onto the photoreceptors, as do the opposite
changes if negative lenses are worn.
To understand how homeostatic control of eye growth brings the nor-
mal eye towards emmetropia and how disturbances of this process cause
myopia, an understanding of the signaling between the tissues of the eye is
important. Although visual control of eye growth can occur within the
249 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 249
eye, without the influence of the brain,
52,53
it appears that, at least in guinea
pigs, the detection of the sign of defocus requires the brain to be con-
nected to the eyes.
22
Whether or not the control of eye-growth is local or
brain-mediated, the retina must signal the defocus, and the choroid must
conduct or create the signals reaching the sclera. We will now discuss each
of these tissues.
Scleral similarities and differences between
humans and chickens
The sclera of chickens differs from that of humans. The chicken has the
classic vertebrate sclera, consisting of a layer of cartilage surrounded by
layers of fibrous connective tissue, whereas in most mammals, including
primates and rodents, the cartilage has been lost, although molecular
traces of its existence persist.
54
One can speculate that the loss of the
cartilage in early mammalian evolution was innocuous because the
precursor of Eutherian mammals had small eyes, which did not require
the reinforcement of the cartilage. However, the consequence of the loss
of cartilage is that whereas birds can have large eyes despite thin (about
120 µm) scleras, mammals with large eyes, such as elephants, have
grotesquely hypertrophied scleras, as much as 8 mm thick,
55
apparently
required to maintain the shape of the large eye (reviewed by McBrien
and Gentle).
56
Despite this difference in scleral anatomy, the fibrous sclera of mam-
mals and the fibrous layer of the avian sclera appear to grow similarly.
When ocular elongation accelerates, the fibrous sclera thins and loses
material both in mammals
57,58
and birds.
59,60
The cartilaginous layer of the
sclera of birds, however, increases its thickness as the eye elongates, and
this is accompanied by an increase in synthesis of proteoglycans.
61–63,60
Because the cartilaginous layer dominates biochemical measurements of
scleral growth, it can mislead one to conclude that the avian sclera grows
oppositely to the mammalian one.
Although one might expect that the cartilage-reinforced sclera of birds
would affect the shape the eye could take, when chicks
64
and monkeys
65
have half of their visual field covered by a diffuser, the eyes expand only in
the visually deprived half, with the boundary between the visually experi-
enced and visually deprived halves being approximately equally sharp in
both species. This is further evidence that the tissue differences between
250 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 250
the two types of sclera do not imply completely different mechanisms of
ocular growth regulation.
What then is the relation between the two layers of the sclera? If the
fibrous and cartilaginous layers from an eye growing toward myopia (or
towards hyperopia) are dissected apart, and each layer is co-cultured with
the opposite layer from a normal eye, it is the fibrous layer that deter-
mines the rate of growth of the “recipient” cartilaginous layer; the condi-
tion of the “donor” cartilaginous layer does not affect the growth of the
“recipient” fibrous layer.
60
If it is the general condition that the fibrous
layer controls the cartilaginous layer, one could suppose that when, in the
course of mammalian evolution, the cartilaginous layer was lost, eye
growth regulation would not have required a major change in the growth
control of the sclera.
These results should not be taken to imply that the fibrous sclera com-
pletely controls the growth of the cartilaginous sclera. We have recently
found that the fibroblast growth factor causes the fibrous layer to increase
its synthesis of proteoglycans and causes the cartilaginous layer to do the
opposite, when the different layers are cultured separately.
66
It is unclear
where this growth factor comes from under natural conditions because it
is also found in the retina, in the nerve fiber layer and inner plexiform
layer,
67
and in choroidal microvascular endothelium
68
and RPE cells.
69
Retinal signals
In part because of the ease of doing experiments on chicks, there is more
known about possible retinal signals that might be registering the degree
and sign of defocus in chicks than in other species. Of particular interest
are molecular signals that go in opposite directions when negative vs. pos-
itive lenses are worn.
Glucagon-insulin
The first of these potential signals discovered was glucagon, in that the
transcription of the immediate early gene ZENK (also known as Egr1,
among other names) increases in glucagonergic amacrine cells, when pos-
itive lenses are worn and decreases when negative lenses are worn,
70,71
these
changes being independent of both illuminance levels and chromatic
cues.
72
Furthermore, exogenous glucagon blocks both the excessive ocular
251 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 251
elongation and choroidal thinning caused by negative lenses
73
and form
deprivation.
74
Curiously, in the eye, as in the liver, insulin has effects opposite to those
of glucagon: it counters the effect of positive lenses, and even in normal
eyes, increases ocular elongation and thins the choroid.
75,73
Furthermore,
glucagon at concentrations too low to have an effect by itself can attenu-
ate the effects of insulin, and vice versa.
73
Injections of glucagon suppress
the proliferation of retinal progenitors in peripheral retina, while injec-
tions of insulin do the opposite.
76
These findings support the hypothesis
that glucagon and insulin may be output signals from the retina that
decode the sign of defocus and modulate eye growth. The site of action of
both may be on retinal pigment epithelial cells, where glucagon and
insulin receptors have been found, or on the sclera, which has insulin
receptors (glucagon:
77,78
; insulin:
79,80
).
Interestingly, there is a subclass of glucagonergic amacrine cells in
young chicks that are located in the peripheral retina, which send axons to
the far peripheral retina. Because these cells are concentrated near the
equator of the eye, and because injections of glucagon suppress equatorial
eye growth, it may be that the expression of glucagon in these neurons
determines the equatorial expansion of the eye,
78
whereas neurons in the
posterior retina may control axial elongation.
At present it is unclear whether there is a primate version of this signal-
ing mechanism. Glucagon has not been found in primate retinal neurons,
although the expression of the transcription factors erg-1 and fra-2 was
found to be decreased in ON-bipolar cells and a subclass of GABA-ergic
cells in primate retinas of eyes wearing diffusers, whereas erg-1 (but not
fra-2) increased in eyes wearing +3 D lenses, which corrected the eye’s nor-
mal hyperopic refractive error,
81
suggesting that in-focus images stimulate
expression of these transcription factors more than blurred or diffused
images. However, because visual stimulation changes the expression of
many transcription factors in many retinal neurons, this difference may
reflect the amount of retinal stimulation rather than a specific signal
related to defocus.
Retinoic acid
Retinoic acid is a metabolic product of vitamin A with a myriad of critical
roles during development. In the retina, retinoic acid increases if eyes are
made to accelerate their elongation by wearing diffusers or negative lenses,
252 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 252
and decreases if eyes are made to slow their elongation (chicks:
82,85
, guinea
pigs
83
). Inhibiting synthesis of retinoic acid reduces form-deprivation
myopia.
84
As will be discussed below, synthesis of retinoic acid by the
choroid also depends on the direction of eye-growth, but the synthesis in
the retina may be uncoupled from that in the choroid, perhaps because the
retina does not secrete much retinoic acid.
85
Therefore, retinal retinoic
acid may be more of an indication of other retinal functions than of a
signal acting on other ocular tissues.
Dopamine
Dopamine is a neurotransmitter used by specific amacrine cells in both
chick and monkey retina. The levels of dopamine are reduced in eyes
wearing diffusers
86
and negative lenses,
87
and increased in eyes recover-
ing from form-deprivation myopia.
88
Injections of apomorphine, a non-
specific dopamine agonist, inhibit the development of form-deprivation
myopia
86,89,90
and lens-induced myopia
91
in both chicks and monkeys,
suggesting a similar role for both species. The mechanism is presumably
mediated via the D2 receptors, as a D2-specific agonist, but not a D1 ago-
nist, is effective in inhibiting deprivation-induced myopia.
92
Despite the promising nature of these results, the findings that reduc-
ing dopamine action either by haloperidol, an antagonist, or 6-hydroxy-
dopamine, which depletes dopamine, also suppresses myopia, casts doubt
on dopamine being a primary growth-inhibitory signal molecule.
92
It remains possible, however, that the conflicting evidence obtained from
these other studies might be a reflection of actions on dopamine receptors
in different tissues, such as the RPE or choroid.
Acetylcholine
A third potential retinal signal molecule is acetylcholine, muscarinic
antagonists of which have been used to prevent myopia in humans for
many years.
93–95
Although originally thought to act on the ciliary muscle
preventing accommodation, it is now clear that this is not the case because
atropine and pirenzepine also inhibit the development of lens- and dif-
fuser-induced myopia in chickens,
96–99,91
in which accommodation is not
mediated by muscarinic receptors. Although the site of action of these
drugs is unknown, evidence for its being retinal is weak: neurotoxin deple-
tion of the cholinergic amacrine cells does not alter the eye’s response to
253 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 253
form deprivation, nor does it alter the effects of atropine.
98,100
Muscarinic
receptors are found in every tissue of the eye.
Choroidal signals
Although it is clear that any molecule influencing scleral growth must
originate in or pass through the choroid, the phenomenon that brought
attention to the physiological state of the choroid was the dramatic thick-
ening that occurred when chick eyes were exposed to myopic defocus
either imposed by positive lenses or prior form-deprivation.
101,102
This
thickening could cause the choroid to increase in thickness by as much as
a millimeter, four times the normal thickness, accounting for at least half
of the refractive compensation to the lens. This response was also found in
rhesus monkeys,
103
marmosets
104
and guinea pigs,
12
but to a much smaller
extent, having little refractive effect.
Although one is tempted to dismiss the choroidal changes in mammals
as insignificant, because they are so small, there is evidence from chicks that
the state of the choroid has a profound influence on the state of the sclera,
and hence on the growth of the eye. Specifically, if one takes the choroid
from an eye with imposed myopia or hyperopia and cultures it with sclera
from an untreated eye, the sclera responds in the direction predicted by the
choroid from which it came: The rate of synthesis of DNA and proteogly-
cans in the sclera is increased in scleras incubated with choroids from eyes
becoming myopic and decreased in scleras with choroids from eyes becom-
ing hyperopic.
60
By the same token, fluid aspirated from the choroid of
slower-growing eyes recovering from deprivation myopia inhibited scleral
proteoglycan synthesis while fluid from eyes becoming myopic stimulated
synthesis.
105
This choroidal modulation of scleral growth is likely the result of
choroidal secretion of signals to which the sclera is sensitive. Potential mol-
ecules include retinoic acid, transforming growth factor-beta (TGF-beta),
and ovotransferrin, all of which have their choroidal content changed
by whether the eye is growing towards myopia or hyperopia, as will be
discussed. In addition, the choroid secretes tissue plasminogen activator,
tPA,
106
which stimulates the production of metalloproteinases and collage-
nases, which degrade extracellular matrix components, as would be
involved in the remodeling of the sclera.
Retinoic acid furnishes a particularly clear example of how this
choroidal modulation of scleral growth might work. The chick choroid,
254 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 254
like that of monkeys, secretes large amounts of retinoic acid.
85,107
If chicks
wear negative lenses or diffusers, which increase ocular elongation, the
synthesis of choroidal retinoic acid falls to barely detectable levels; and
with positive lenses or removal of a diffuser, both of which decrease ocu-
lar elongation, the synthesis increases four-fold. Furthermore, retinoic
acid inhibits scleral proteoglycan synthesis in chick sclera.
85
Thus, the
increased secretion of retinoic acid by the choroid inhibits the growth of
the cartilaginous layer of the chick sclera; under normal circumstances this
would be associated with an increase in growth of the fibrous sclera. It is
not known whether retinoic acid independently affects the growth of the
fibrous sclera in birds.
In mammals, however, this is known. In marmosets
107
and guinea pigs,
108
increased ocular elongation in response to form deprivation (or negative
lens wear in guinea pigs) is associated with an increase in choroidal
retinoic acid and an inhibition of scleral proteoglycan synthesis; treating
marmoset sclera with retinoic acid also inhibits proteoglycan synthesis.
Thus, retinoic acid inhibits overall scleral growth in both birds and mam-
mals, although this inhibition is associated with ocular elongation being
increased in mammals and decreased in birds because of the difference in
scleral structure.
Ovotransferrin is also greatly increased in choroids of chick eyes with
inhibited elongation caused by removing diffusers, and it too inhibits
scleral proteoglycan synthesis in vitro,
109
supporting a role as a growth
inhibitor.
Transforming growth factor-beta (TGF-beta) is synthesized by the
choroid of chickens,
71
tree shrews
110
and humans,
111
and has many func-
tions, among them extracellular matrix remodeling.
111
TGF-beta has been
reported to be increased in ocular tissues of form-deprived chicken
eyes
112
and antagonizes the growth-inhibitory effects of basic fibroblast
growth factor (bFGF) in chicks,
113
supporting a role as a growth-stimula-
tor. However, subsequent findings from chicks and tree shrews
71,110
do not
support this role for TGF-beta being a major choroidal growth regulator.
The Role of the Choroid in the Control of Ocular Growth
The overall similarity of the effects of visual experience on eye-growth in
birds and mammals suggests that the underlying mechanisms are proba-
bly conserved. How, then, is one to reconcile the order-of-magnitude
255 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 255
differences in the defocus-induced choroidal thickness changes between
birds and mammals with the presumed similarity of control of eye
growth? One possibility is that the choroid contains two independent
tissues: the stroma, which thickens and thins in response to changes in
refractive state
101
as a result of changes in the volume of the lymphatic
lacunae,
114
and a secretory tissue, perhaps the lamina fusca, which faces the
sclera. If this is so, the choroidal thickening response would be independ-
ent of the secretory functions of the choroid. Alternatively, the choroidal
thickening and thinning may reflect the physiological state of the choroid,
which might determine what growth-modulating molecules are secreted.
The evidence in favor of this coupling is that a variety of visual manipula-
tions that inhibit ocular elongation also cause a transient choroidal thick-
ening lasting only a few hours, which would generally not be detected in
eye-growth experiments lasting days. For example, wearing negative lenses
causes chick eyes to rapidly elongate and become myopic, but removal of
the lenses for two hours per day cancels both of these effects and causes a
transient choroidal thickening.
115
Inhibiting this daily thickening by pre-
venting nitric oxide synthesis causes the eye to continue to elongate as
though wearing the negative lenses continuously.
116
It would be interesting
to see if the same transient changes in choroidal thickness are associated
with inhibition of elongation in primates.
Diurnal rhythms and control of ocular growth
During growth of a tissue, cells generally alternate between dividing and
synthesizing. In the case of tissues like the sclera, this means that cells stop
synthesizing extracellular matrix when they are dividing. If individual cells
divided asynchronously, this alternation would not be evident in any
measure of growth, either at the tissue synthetic level or at the organ level.
However, it is clear not only that the eye elongates with a daily rhythm,
growing more during the day than at night,
117–119
but also that the growth
of isolated pieces of sclera is controlled by a circadian oscillator.
120
This
means that there must be substantial synchrony of the chondrocytes
within the tissue. There are two lines of evidence that this diurnal growth
rhythm is modulated by vision.
First, dopamine and melatonin constitute a reciprocal system that
mediates ocular diurnal rhythms, with dopamine being the “day” signal
and melatonin the “night” signal, controlling rod and cone sensitivity,
retinomotor movements, and pigment dispersal in RPE cells (review:
121
).
256 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 256
Both molecules seem to be involved in the visual control of eye-growth:
day-time, but not night-time, levels of dopamine are reduced by form-
deprivation,
86
and apomorphine, a non-specific dopamine agonist,
inhibits the development of myopia induced by wearing diffusers or neg-
ative lenses in both chicks
86,90,91
and monkeys.
89
Melatonin is a potent
modulator of retinal dopamine release,
122,123
but also has receptors in the
cornea, lens, choroid, and sclera.
124
Systemic administration of melatonin
at night resulted in a significant increase in vitreous chamber depth in
normal chick eyes and choroidal thinning in form-deprived eyes,
124
and
one of the three types of melatonin receptors is increased in the retina/
RPE/choroid in form-deprived eyes.
Second, in growing chick eyes, there are diurnal rhythms in choroidal
thickness and in the rate of ocular elongation, the phases of which are
nearly opposite, with the choroid being thickest at night and the eye
longest during the day.
118
Inhibition of ocular elongation by positive lenses
shifts the two rhythms into near-synchrony, whereas acceleration of ocu-
lar elongation shifts the rhythms into anti-phase.
125
The phase difference
between the rhythms in axial length and choroid thickness predicts the
rate of growth on the following day in individual animals when the sign of
defocus is switched from myopic to hyperopic or vice versa.
Although equivalent studies have not been done on mammals, there
are rhythms in axial length and choroidal thickness in humans
126,127
and
marmosets.
128
When marmosets are young, with rapidly elongating eyes,
the two rhythms are in approximate anti-phase, whereas in older adoles-
cents, in whom growth has slowed, the rhythms are closer in phase, anal-
ogous to the patterns seen in chicks with different rates of ocular growth.
If choroidal thickness is correlated with the molecules that the choroid
is releasing, as suggested in the previous section, perhaps these molecules
stimulate ocular elongation more at one portion of the cycle than at
another, or perhaps modulators of metalloproteinases involved in scleral
remodeling, such as tPA, may be more effective at certain points in the daily
cycle. Finally, the effect of bright light outdoors in preventing chicken
129
and human
130
myopia may act by stimulation of dopamine release.
Conclusions
The eyes of a wide variety of vertebrates adjust their growth using visual
cues. The pervasive similarities in the mechanisms shown to operate in
257 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 257
chicks and primates suggest that the emmetropization machinery has been
highly conserved in evolution. The bidirectional modulation of eye
growth by hyperopic and myopic defocus in disparate species suggests that
the same may occur in children. This possibility should not be ignored in
considering what might make children myopic and what could be done to
prevent it. Furthermore, the similar local effects in chicks and monkeys of
defocus limited to one region of the retina implies that one must study the
peripheral refractions in humans to understand the etiology of myopia.
This, in turn, implies that one must consider the effects of alternating peri-
ods of myopic and hyperopic defocus, because all regions of the retina are
continuously exposed to these alternations with the exception of the fovea,
which is kept more-or-less in focus by ocular accommodation. From the
animal work, it appears likely that understanding the spatial and temporal
distribution of defocus will go a long way to understanding human
myopia.
References
1. Sherman SM, Norton TT, Casagrande VA. (1977) Myopia in the lid-sutured
tree shrew (Tupaia glis). Brain Res 124: 154–157.
2. Wiesel TN, Raviola E. (1977) Myopia and eye enlargement after neonatal lid
fusion in monkeys. Nature 266: 66–68.
3. Wallman J, Turkel J, Trachtman J. (1978) Extreme myopia produced by
modest changes in early visual experience. Science 201: 1249–1251.
4. O’Leary DJ, Millodot M. (1979) Eyelid closure causes myopia in humans.
Experientia 35: 1478–1479.
5. Barathi VA, Boopathi VG, Yap EP, Beuerman RW. (2008) Two models of
experimental myopia in the mouse. Vision Res 48: 904–916.
6. Tkatchenko TV, Shen Y, Tkatchenko AV. (2010) Mouse Experimental
Myopia Has Features of Primate Myopia. Invest Ophthalmol Vis Sci 51(3):
1297–1303.
7. Schaeffel F, Glasser A, Howland HC. (1988) Accommodation, refractive
error and eye growth in chickens. Vision Res 28: 639–657.
8. Hung LF, Crawford ML, Smith EL. (1995) Spectacle lenses alter eye growth
and the refractive status of young monkeys. Nature Med 1: 761–765.
9. Whatham AR, Judge SJ. (2001) Compensatory changes in eye growth and
refraction induced by daily wear of soft contact lenses in young marmosets.
Vision Res 41: 267–273.
10. Shen W, Sivak JG. (2007) Eyes of a lower vertebrate are susceptible to the
visual environment. Invest Ophthalmol Vis Sci 48: 4829–4837.
258 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 258
11. Metlapally S, McBrien NA. (2008) The effect of positive lens defocus on
ocular growth and emmetropization in the tree shrew. J Vis 8(1): 1–12.
12. Howlett M, McFadden S. (2009) Spectacle lens compensation in the
pigmented guinea pig. Vision Res 49: 219–227.
13. Gwiazda J, Hyman L, Hussein M, et al. (2003) A randomized clinical trial of
progressive addition lenses versus single vision lenses on the progression of
myopia in children. Invest Ophthal Vis Sci 44: 1492–1500.
14. Phillips JR. (2005) Monovision slows juvenile myopia progression unilater-
ally. Br J Ophthalmol 89: 1196–1200.
15. Field DJ, Brady N. (1997) Visual sensitivity, blur and the sources of
variability in the amplitude spectra of natural scenes. Vision Res 37:
3367–3383.
16. Georgeson MA, May KA, Freeman TC, Hesse GS. (2007) From filters to
features: scale-space analysis of edge and blur coding in human vision. J Vis
7(7): 1–21.
17. Schaeffel F, Diether S. (1999) The growing eye: an autofocus system that
works on very poor images. Vision Res 39: 1585–1589.
18. Park T, Winawer J, Wallman J. (2003) Further evidence that chicks use the
sign of blur in spectacle lens compensation. Vision Res 43: 1519–1531.
19. McLean RC, Wallman J. (2003) Severe astigmatic blur does not interfere
with spectacle lens compensation. Invest Ophthal Vis Sci 44: 449–457.
20. Whatham AR, Judge SJ. (2001) Compensatory changes in eye growth and
refraction induced by daily wear of soft contact lenses in young marmosets.
Vision Res 41: 267–273.
21. Troilo D, Totonelly K, Harb E. (2009) Imposed anisometropia, accommoda-
tion, and regulation of refractive state. Optom Vis Sci 86: E31–E39.
22. McFadden S, Wildsoet C. (2009) Mammalian eyes need an intact optic nerve
to detect the sign of defocus during emmetropization. Invest Ophthalmol Vis
Sci E-Abstract #1620. 50.
23. Norton TT, Siegwart JT, Jr., Amedo AO. (2006) Effectiveness of hyperopic
defocus, minimal defocus, or myopic defocus in competition with a
myopiagenic stimulus in tree shrew eyes. Invest Ophthalmol Vis Sci 47:
4687–4699.
24. Nickla DL, Sharda V, Troilo D. (2005) Temporal integration characteristics
of the axial and choroidal responses to myopic defocus induced by prior
form deprivation versus positive spectacle lens wear in chickens. Optom Vis
Sci 82: 318–327.
25. Schaeffel F, Howland HC. (1991) Properties of the feedback loops control-
ling eye growth and refractive state in the chicken. Vision Res 31: 717–734.
26. Wildsoet CF, Schmid KL. (2000) Optical correction of form deprivation
myopia inhibits refractive recovery in chick eyes with intact or sectioned
optic nerves. Vision Res 40: 3273–3282.
259 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 259
27. Norton TT, Amedo AO, Siegwart JT, Jr. (2006) Darkness causes myopia
in visually experienced tree shrews. Invest Ophthalmol Vis Sci 47:
4700–4707.
28. Smith EL, 3rd, Hung LF. (1999) The role of optical defocus in regulating
refractive development in infant monkeys. Vision Res 39: 1415–1435.
29. Tepelus TC, Schaeffel F. (2010) Individual set-point and gain of
emmetropization in chickens. Vision Res 50(1): 57–64.
30. Jansonius NM, Kooijman AC. (1998) The effect of spherical and other
aberrations upon the modulation transfer of the defocussed human eye.
Ophthalmic Physiol Opt 18: 504–513.
31. Tarrant J, Severson H, Wildsoet CF. (2008) Accommodation in emmetropic
and myopic young adults wearing bifocal soft contact lenses. Ophthalmic
Physiol Opt 28: 62–72.
32. Radhakrishnan H, Pardhan S, Calver RI, O’Leary DJ. (2004) Effect of posi-
tive and negative defocus on contrast sensitivity in myopes and non-
myopes. Vision Res 44: 1869–1878.
33. Wilson BJ, Decker KE, Roorda A. (2002) Monochromatic aberrations pro-
vide an odd-error cue to focus direction. J Opt Soc Am A Opt Image Sci Vis
19: 833–839.
34. Irving EL, Sivak JG, Callender MG. (1992) Refractive plasticity of the devel-
oping chick eye. Ophthalmic Physiol Opt 12: 448–456.
35. Rucker FJ, Wallman J. (2009) Chick eyes compensate for chromatic simula-
tions of hyperopic and myopic defocus: evidence that the eye uses longitu-
dinal chromatic aberration to guide eye-growth. Vision Res 49: 1775–1783.
36. Lee JH, Stark LR, Cohen S, Kruger PB. (1999) Accommodation to static
chromatic simulations of blurred retinal images. Ophthalmic Physiol Opt
19: 223–235.
37. Fitzke FW, Hayes BP, Hodos W, et al. (1985) Refractive sectors in the visual
field of the pigeon eye. J Physiol 369: 33–44.
38. Crewther SG, Crewther DP. (2003) Inhibition of retinal ON/OFF systems
differentially affects refractive compensation to defocus. Neuroreport 14:
1233–1237.
39. Wallman J, Gottlieb MD, Rajaram V, Fugate-Wentzek LA. (1987) Local reti-
nal regions control local eye growth and myopia. Science 237: 73–77.
40. Diether S, Schaeffel F. (1997) Local changes in eye growth induced by
imposed local refractive error despite active accommodation. Vision Res 37:
659–668.
41. Smith EL, 3rd, Huang J, Hung LF, et al. (2009) Hemiretinal form depriva-
tion: evidence for local control of eye growth and refractive development in
infant monkeys. Invest Ophthal Vis Sci 50: 5057–5069.
42. Ferree GR, Rand G, Hardy C. (1931) Refraction for the peripheral field of
vision. Arch Opthal 8: 717–731.
260 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 260
43. Hoogerheide J, Rempt F, Hoogenboom WP. (1971) Acquired myopia in
young pilots. Ophthalmologica 163: 209–215.
44. Mutti DO, Hayes JR, Mitchell GL, et al. (2007) Refractive error, axial length,
and relative peripheral refractive error before and after the onset of myopia.
Invest Ophthal Vis Sci 48: 2510–2519.
45. Rose KA, Morgan IG, Ip J, et al. (2008) Outdoor activity reduces the preva-
lence of myopia in children. Ophthalmology 115: 1279–1285.
46. Winawer J, Wallman J. (2002) Temporal constraints on lens compensation
in chicks. Vision Res 42: 2651–2668.
47. Zhu X, Winawer J, Wallman J. (2003) The potency of myopic defocus in
lens-compensation. Invest Ophthalmol Vis Sci 44: 2818–2827.
48. Winawer J, Zhu X, Choi J, Wallman J. (2005) Ocular compensation for alter-
nating myopic and hyperopic defocus. Vision Res 45: 1667–1677.
49. Zhu X, Wallman J. (2009) Temporal properties of compensation for
positive and negative spectacle lenses in chicks. Invest Ophthalmol Vis Sci
50: 37–46.
50. Smith EL, 3rd, Hung LF, Kee CS, Qiao Y. (2002) Effects of brief periods of
unrestricted vision on the development of form-deprivation myopia in
monkeys. Invest Ophthalmol Vis Sci 43: 291–299.
51. Ciuffreda KJ, Wallis DM. (1998) Myopes show increased susceptibility to
nearwork aftereffects. Invest Ophthal Vis Sci 39: 1797–1803.
52. Troilo D, Gottlieb MD, Wallman J. (1987) Visual deprivation causes myopia
in chicks with optic nerve section. Curr Eye Res 6: 993–999.
53. Wildsoet CF, Pettigrew JD. (1988) Experimental myopia and anomalous eye
growth patterns unaffected by optic nerve section in chickens: evidence for
local control of eye growth. Clin Vis Sci 3: 99–107.
54. Poole AR, Pidoux I, Reiner A, et al. (1982) Mammalian eyes and associated
tissues contain molecules that are immunologically related to cartilage pro-
teoglycans and link protein. J Cell Biol 93: 910–920.
55. Murphy C, Kern T, Howland H. (1992) Refractive state, corneal curvature,
accommodative range and ocular anatomy of the Asian elephant (Elephas
maximus). Vision Res 32: 2013–2021.
56. McBrien N, Gentle A. (2003) Role of the sclera in the development
and pathological complications of myopia. Prog Retinal Eye Res 22:
307–338.
57. Norton T, Rada J. (1995) Reduced extracellular matrix in mammalian sclera
with induced myopia. Vision Res 1271–1281.
58. Rada JA, Nickla DL, Troilo D. (2000) Decreased proteoglycan synthesis
associated with form deprivation myopia in mature primate eyes. Invest
Ophthalmol Vis Sci 41: 2050–2058.
59. Gottlieb MD, Joshi HB, Nickla DL. (1990) Scleral changes in chicks with
form-deprivation myopia. Curr Eye Res 9: 1157–1165.
261 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 261
60. Marzani D, Wallman J. (1997) Growth of the two layers of the chick sclera is
modulated reciprocally by visual conditions. Invest Ophthalmol Vis Sci 38:
1726–1739.
61. Rada JA, Thoft RA, Hassell JR. (1991) Increased aggrecan (cartilage proteo-
glycan) production in the sclera of myopic chicks. Developmental Biology
147: 303–312.
62. Rada JA, McFarland AL, Cornuet PK, Hassell JR. (1992) Proteoglycan syn-
thesis by scleral chondrocytes is modulated by a vision dependent mecha-
nism. Curr Eye Res 11: 767–782.
63. Rada JA, Matthews AL. (1994) Visual deprivation upregulates extracellular
matrix synthesis by chick scleral chondrocytes. Invest Ophthalmol Vis Sci 35:
2436–2447.
64. Wallman J, Gottlieb MD, Rajaram V, Fugate-Wentzek LA. (1987) Local reti-
nal regions control local eye growth and myopia. Science 237: 73–77.
65. Smith EL, Huang J, Hung LF, et al. (2009) Hemiretinal form deprivation:
evidence for local control of eye growth and refractive development in
infant monkeys. Invest Ophthalmol Vis Sci 50: 5057–5069.
66. Zhu X, Garzon A, Wallman J. (2009) FGF has opposite effects on the fibrous
and cartilaginous layers of the chick sclera. Invest Ophthalmol Vis Sci
E-abstract #3842.
67. de longh R, McAvoy J. (1992) Distribution of acidic and basic fibroblast
growth factor (FGF) in the foetal rat eye: Implications for lens development.
Growth Factors 6: 159–177.
68. Keithahn M, Aotaki-Keen A, Schneeberger S, et al. (1997) Expression of
fibroblast growth factor-5 by bovine choroidal endothelial cells in vitro.
Invest Ophthalmol Vis Sci 38: 2073–2080.
69. Schweigerer L, Malerstein B, Neufeld G, Gospodarowicz D. (1987) Basic
fibroblast growth factor is synthesized in cultured retinal pigment epithelial
cells. Biochem Biophys Res Commun 143: 934–940.
70. Fischer A, McGuire J, Schaeffel F, Stell W. (1999) Light and defocus-dependent
expression of the transcription factor ZENK in the chick retina. Nat Neurosci
2: 706–712.
71. Simon P, Feldkaemper M, Bitzer M, et al. (2004) Early transcriptional
changes of retinal and choroidal TGFB-2, RALD-2, and ZENK following
imposed positive and negative defocus in chickens. Mol Vis 10: 588–597.
72. Bitzer M, Schaeffel F. (2002) Defocus-induced changes in ZENK expression
in the chicken retina. Invest Ophthalmol Vis Sci 43: 246–252.
73. Zhu X, Wallman J. (2009) Opposite effects of glucagon and insulin on
competition for spectacle lenses in chicks. Invest Ophthalmol Vis Sci 50:
24–36.
74. Vessey KA, Lencses KA, Rushforth DA, et al. (2005) Glucagon receptor
agonists and antagonists affect the growth of the chick eye: a role for
262 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 262
glucagonergic regulation of emmetropization. Invest Ophthalmol Vis Sci 46:
3922–3931.
75. Feldkaemper M, Neacsu I, Schaeffel F. (2009) Insulin acts as a powerful
stimulator of axial myopia in chicks. Invest Ophthalmol Vis Sci 50: 13–23.
76. Fischer A, Omar G, Walton N, et al. (2005) Glucagon-expressing neurons
within the retina regulate the proliferation of neural progenitors in the
circumferential marginal zone of the avian eye. J Neurosci 25: 10157–10166.
77. Buck L, Schaeffel F, Simon P, Feldkaemker M. (2004) Effects of positive and
negative lens treatment on retinal and choroidal glucagon and glucagon
recepter mRNA levels in the chicken. Invest Ophthamol 45(2): 402–409.
78. Fischer A, Ritchey E, Scott M, Wynne A. (2008) Bullwhip neurons in the
retina regulate the size and shape of the eye. Dev Biol 317: 196–212.
79. Waldbillig R, Arnold D, Fletcher R, Chader G. (1990) Insulin and IGF-1
binding in chick sclera. Invest Ophthalmol Vis Sci 31: 1015–1022.
80. Waldbillig R, Arnold D, Fletcher R, Chader G. (1991) Insulin and IGF-1
binding in developing chick neural retina and pigment epithelium: a char-
acterization of binding and structural differences. Exp Eye Res 53: 13–22.
81. Zhong X, Ge J, Smith EL, Stell W. (2004) Image defocus modulates activity
of bipolar and amacrine cells in macaque retina. Invest Ophthalmol Vis Sci
45: 2065–2074.
82. Seko Y, Shimizu M, Tokoro T. (1998) Retinoic acid increases in the retina of
the chick with form deprivation myopia. Ophthalmic Res 30: 361–367.
83. McFadden SA, Howlett MH, Mertz JR. (2004) Retinoic acid signals the
direction of ocular elongation in the guinea pig eye. Vision Res 44: 643–653.
84. Bitzer M, Feldkaemper M, Schaeffel F. (2000) Visually induced changes in
components of the retinoic acid system in fundal layers of the chick. Exp Eye
Res 70: 97–106.
85. Mertz JR, Wallman J. (2000) Choroidal retinoic acid synthesis: a possible
mediator between refractive error and compensatory eye growth. Exp Eye
Res 70: 519–527.
86. Stone RA, Lin T, Laties AM, Iuvone PM. (1989) Retinal dopamine and form-
deprivation myopia. Proc Nat Acad Sci 86: 704–706.
87. Guo SS, Sivak JG, Callender MG, Diehljones B. (1995) Retinal dopamine
and lens-induced refractive errors in chicks. Curr Eye Res 14: 385–389.
88. Pendrak K, Nguyen T, Lin T, et al. (1997) Retinal dopamine in the recovery
from experimental myopia. Curr Eye Res 16: 152–157.
89. Luvone PM, Tigges M, Stone RA, et al. (1991) Effects of apomorphine, a
dopamine receptor agonist, on ocular refraction and axial elongation in a
primate model of myopia. Invest Ophthalmol Vis Sci 32: 1674–1677.
90. Rohrer B, Spira AW, Stell WK. (1993) Apomorphine blocks form-depriva-
tion myopia in chickens by a dopamine D2-receptor mechanism acting in
retina or pigmented epithelium. Vis Neurosci 10: 447–453.
263 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 263
91. Schmid KL, Wildsoet C. (2004) Inhibitory effects of apomorphine and
atropine and their combination on myopia in chicks. Optometry Vis Sci 81:
137–147.
92. Schaeffel F, Bartmann M, Hagel G, Zrenner E. (1995) Studies on the role of
the retinal dopamine/melatonin system in experimental refractive errors in
chickens. Vision Res 35: 1247–1264.
93. Bedrossian RH. (1971) The effect of atropine on myopia. Ann Ophthalmol
3: 891–897.
94. Shih YF, Chen CH, Chou AC, et al. (1999) Effects of different concentrations
of atropine on controlling myopia in myopic children. J Ocular Pharm
Therapeut 15: 85–90.
95. Kennedy RH, Dyer JA, Kennedy MA, et al. (2000) Reducing the progression
of myopia with atropine: a long term cohort study of Olmsted County stu-
dents. Binocul Vis Strabismus Q 15: 281–304.
96. Stone RA, Lin T, Laties AM. (1991) Muscarinic antagonist effects on exper-
imental chick myopia. Exp Eye Res 52: 755–7588.
97. McBrien NA, Moghaddam HO, Reeder AP. (1993) Atropine reduces experi-
mental myopia and eye enlargement via a nonaccommodative mechanism.
Invest Ophthalmol Vis Sci 34: 205–215.
98. Schwahn HN, Schaeffel F. (1994) Chick eyes under cycloplegia compensate
for spectacle lenses despite six-hydroxy dopamine treatment. Invest
Ophthalmol Vis Sci 35: 3516–3524.
99. Luft W, Ming Y, Stell W. (2003) Variable effects of previously untested mus-
carinic receptor antagonists on experimental myopia. Invest Ophthalmol Vis
Sci 44: 1330–1338.
100. Fischer A, Miethke P, Morgan I, Stell W. (1998) Cholinergic amacrine cells
are not required for the progression and atropine-mediated suppression of
form deprivation myopia. Brain Res 794: 48–60.
101. Wallman J, Wildsoet C, Xu A, et al. (1995) Moving the retina: choroidal
modulation of refractive state. Vision Res 35: 37–50.
102. Wildsoet C, Wallman J. (1995) Choroidal and scleral mechanisms of com-
pensation for spectacle lenses in chicks. Vision Res 35: 1175–1194.
103. Hung L-F, Wallman J, Smith EI. (2000) Vision-dependent changes in the
choroidal thickness of Macaque monkeys. Invest Ophthalmol Vis Sci 41:
1259–1269.
104. Troilo D, Nickla D, Wildsoet C. (2000) Choroidal thickness changes during
altered eye growth and refractive state in a primate. Invest Ophthalmol Vis Sci
41: 1249–1258.
105. Rada J, Palmer L. (2007) Choroidal regulation of scleral glycosaminoglycan
synthesis during recovery from induced myopia. Invest Ophthalmol Vis Sci
48: 2957–2966.
264 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 264
106. Wang Y, Gilliles C, Cone RE, O’Rourke J. (1995) Extravascular secretion of
t-PA by the intact superfused choroid. Invest Ophthalmol Vis Sci 36:
1625–1632.
107. Troilo D, Nickla D, Mertz J, Summers Rada J. (2006) Change in the synthe-
sis rates of ocular retinoic acid and scleral glycosaminoglycan during exper-
imentally altered eye growth in marmosets. Invest Ophthalmol Vis Sci 47:
1768–1777.
108. McFadden S, Howlett M, Mertz J. (2004) Retinoic acid signals the direction
of ocular elongation in the guinea pig eye. Vision Res 44: 643–653.
109. Rada J, Huang Y, Rada K. (2001) Identification of choroidal ovotransferrin
as a potential ocular growth regulator. Curr Eye Res 22: 121–132.
110. Jobling AI, Wan R, Gentle A, Bui BV, McBrien N. (2009) Retinal and
choroidal TGF-B in the tree shrew model of myopia: Isoform expression,
activation and effects on function. Exp Eye Res 88: 458–466.
111. Lutty GA, Merges C, Threlkeld AB, Crone S, McLeod DS. (1993)
Heterogeneity in localization of isoforms of TGF-beta in human retina, vit-
reous, and choroid. Invest Ophthalmol Vis Sci 34: 477–487.
112. Seko Y, Shimokawa H, Tokoro T. (1995) Expression of bFGF and TGF-B2 in
experimental myopia in chicks. Invest Ophthalmol Vis Sci 36: 1183–1187.
113. Rohrer B, Stell WK. (1994) Basic Fibroblast Growth-Factor (Bfgf) and
Transforming Growth-Factor-Beta (TGF-Beta) Act as Stop and Go signals to
modulate postnatal ocular growth in the chick. Exp Eye Res 58: 553–561.
114. Liang H, Crewther S, Crewther D, Junghans B. (2004) Structural and ele-
mental evidence for edema in the retina, retinal pigment epithelium, and
choroid during recovery from experimentally induced myopia. Invest
Ophthalmol Vis Sci 45: 2463–2474.
115. Nickla D. (2007) Transient increases in choroidal thickness are consistently
associated with brief daily visual stimuli that inhibit ocular growth in chicks.
Exp Eye Res 84: 951–959.
116. Nickla D, Wilken E, Lytle G, et al. (2006) Inhibiting the transient choroidal
thickening response using the nitric oxide synthase inhibitor L-NAME pre-
vents the ameliorative effects of visual experience on ocular growth in two
different visual paradigms. Exp Eye Res 83: 456–464.
117. Weiss S, Schaeffel F. (1993) Diurnal growth rhythms in the chicken eye:
Relation to myopia development and retinal dopamine levels. J Comp
Physiol A 172: 263–270.
118. Nickla DL, Wildsoet C, Wallman J. (1998) Visual influences on diurnal
rhythms in ocular length and choroidal thickness in chick eyes. Exp Eye Res
66: 163–181.
119. Papastergiou GI, Schmid GF, Riva CE, et al. (1998) Ocular axial length and
choroidal thickness in newly hatched chicks and one-year-old chickens
265 The Relevance of Studies in Chicks for Understanding Myopia in Humans
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 265
fluctuate in a diurnal pattern that is influenced by visual experience and
intraocular pressure changes. Exp Eye Res 66: 195–205.
120. Nickla DL, Rada JA, Wallman J. (1999) Isolated chick sclera shows a circa-
dian rhythm in proteoglycan synthesis perhaps associated with the rhythm
in ocular elongation. J Comp Physiol [A] 185: 81–90.
121. Besharse JC, Iuvone PM, Pierce ME. (1988) Regulation of rhythmic
photoreceptor metabolism: a role for post-receptoral neurons. Prog Retinal
Res 7: 21–61.
122. Ribelayga C, Wang Y, Mangel SC. (2004) A circadian clock in the fish retina
regulates dopamine release via activation of melatonin receptors. J Physiol
554: 467–482.
123. Lorenc-Duda A, Berezinska M, Urbanska A, et al. (2009) Dopamine in the
turkey retina — an impact of environmental light, circadian clock, and
melatonin. J Mol Neurosci 38: 12–18.
124. Summers Rada J, Wiechmann A. (2006) Melatonin receptors in chick ocular
tissues: implications for a role of melatonin in ocular growth regulation.
Invest Ophthalmol Vis Sci 47: 25–33.
125. Nickla D. (2006) The phase relationships between the diurnal rhythm in
axial length and choroidal thickness and the association with ocular growth
rate in chicks. J Comp Physiol A 192: 399–407.
126. Stone RD, Quinn GE, Francis EL, et al. (2004) Diurnal axial length fluctua-
tions in human eyes. Invest Ophthalmol Vis Sci 45: 63–70.
127. Brown JS, Flitcroft DI, Ying G, et al. (2009) In vivo human choroidal thick-
ness measurements: Evidence for diurnal fluctuations. Invest Ophthalmol Vis
Sci 50: 5–12.
128. Nickla D, Wildsoet C, Troilo D. (2002) Diurnal rhythms in intraocular pres-
sure, axial length, and choroidal thickness in a primate model of eye growth,
the common marmoset. Invest Ophthalmol Vis Sci 43: 2519–2528.
129. Ashby R, Ohlendorf A, Schaeffel F. (2009) The effect of ambient illuminance
on the development of deprivation myopia in chicks. Invest Ophthalmol Vis
Sci 50: 5348–5354.
130. Rose K, Morgan I, Ip J, et al. (2008) Outdoor activity reduces the prevalence
of myopia in children. Ophthalmology 116: 1229–1230.
266 J. Wallman and D.L. Nickla
b846_Chapter-4.1.qxd 4/8/2010 2:01 AM Page 266
The Mechanisms Regulating Scleral
Change in Myopia
Neville A. McBrien*
Myopia is one of the most prevalent ocular conditions and is the result of a
mismatch between the power and axial length of the eye. As a result, images
of distant objects are brought to a focus in front of the retina, resulting in
blurred vision. In the vast majority of cases, the structural cause of myopia
is an excessive axial length of the eye, or more specifically, the vitreous
chamber depth. In about 3% of the general population in Europe, USA and
Austraila, the degree of myopia is above 6 dioptres and is termed high
myopia. In South East Asia the figure is closer to 20% of the general popu-
lation with high myopia. The prevalence of sight-threatening ocular pathol-
ogy is markedly increased in eyes with high degrees of myopia (> –6D). This
results from the excessive axial elongation of the eye, which, by necessity,
must involve the outer coat of the eye, the sclera. Consequently, high
myopia is reported as a leading cause of registered blindness and partial
sight. Current theories of refractive development acknowledge the pivotal
role of the sclera in the control of eye size and the development of myopia.
This chapter considers the major structural, biochemical, and biomechani-
cal mechanisms that underlie abnormal development of the mammalian
sclera in myopia. This chapter will characterize the aberrant mechanisms of
scleral remodelling that underlie the development of myopia. In describing
these mechanisms, certain critical events in both the early and later stages of
myopia development that lead to scleral thinning, the loss of scleral tissue,
the weakening of the scleral mechanical properties and, ultimately, to the
development of posterior staphyloma will be reviewed. In conclusion, it will
be proposed that the prevention of aberrant scleral remodelling must be the
267
4.2
*Corresponding author. Department of Optometry and Vision Sciences, The University of Melbourne,
Victoria 3010, Australia. E-mail: [email protected]
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 267
goal of any long-term therapy to reduce the permanent vision loss associ-
ated with high myopia.
Introduction
Myopia is a common refractive error in which the resultant focal
length of the optical components of the eye is incompatible with its over-
all axial length. In the vast majority of cases of human myopia (>95%),
the refractive error develops due to excessive axial eye size, and not
through changes in corneal or lens power.
1
Indeed, the single structural
correlate responsible for this excessive axial eye size in human myopia
of either youth-onset or adult-onset is an enlarged vitreous chamber
depth.
2
Myopia has a high prevalence in the human population, with some
degree of myopia present in 20–30% of individuals in North American,
European, and Australian populations.
3–5
In selected South-East Asian
populations the prevalence is reported to be as high 80%.
6,7
High degrees
of myopia, typically classed as in excess of 6 dioptres (D), are of major
concern due to the fact that the incidence of myopia-related pathology,
often in the form of chorioretinal degenerations and/or retinal detach-
ments, is significantly increased.
8,9
In fact, up to 70% of myopes over 6 D
are reported to have sight-threatening ocular pathology.
10
Prevalence stud-
ies indicate that 12–15% of all myopes have refractive errors over –6 D,
resulting in a prevalence of high myopia in the general population of
approximately 3%.
11
The ocular pathology associated with high myopia is
among the leading causes of registered blindness and partial sight in pop-
ulations of the developed world.
12
Given that high myopia is invariably
due to increased eye size, the mechanical stresses placed on the retina and
choroid during eye movements are greatly increased in larger eyes, impli-
cating the mechanical consequences of increased eye size in the develop-
ment of chorioretinal pathology.
13,14
In conjunction with a pathological
weakening of the sclera,
15
the above observations demonstrate the impor-
tance of the sclera in maintaining eye size.
Postnatal eye growth is constrained by the properties of the outer coat
of the eye. The sclera comprises by far the major component of the ocular
coat. The sclera is a fibrous shell of collagenous, fibroblast maintained
connective tissue, which is continuous with the cornea anteriorly forming
268 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 268
an essentially closed shell around the structures of the anterior, equatorial,
and posterior eye. Although historically the sclera has been considered a
relatively inert tissue in metabolic terms, more recent research has shown
it to undergo constant remodelling during eye growth, continuing
throughout life, albeit at a lesser degree.
16
In common with other special-
ized connective tissues, the sclera is highly organized, enabling it to per-
form its roles. A major functional role of the sclera is the protection of the
delicate intra-ocular structures. However, the sclera plays important roles
in accommodation, by providing a stable base for the contraction of the
ciliary muscle, in promoting accurate eye movements, by providing a sta-
ble base for extraocular muscle contractions, and in allowing vascular and
neural access to adjacent intra-ocular structures. Most importantly from
the viewpoint of this chapter, the sclera, through maintenance of stable
ocular dimensions, is critical in determining the absolute size of the eye,
and thus plays an important role in determining the absolute refractive
error of the eye.
Due to the limitations of studies on post-mortem human myopic
eyes in elucidating the biological mechanisms underlying myopia
development, researchers have developed suitable animal models of the
condition. Since the development of the first animal models of myopia
in the 1970’s,
17
greater understanding of the mechanisms underlying
scleral thinning during the development of high myopia has been
possible.
The context of this review is focussed on the role of the sclera in
myopia development and its implications for understanding and treating
the human condition. Therefore, most of the discussion of data
from experimental models will concentrate on the well-characterized
mammalian models of myopia, namely the tree shrew, marmoset,
and monkey, whose scleral structure is known to be similar to human.
In particular, as the most detailed studies of the role of the sclera in
myopia have been conducted on the tree shrew model, results from
this model will feature strongly. The tree shrew is a diurnal mammal,
close to the primate line, with a cone-dominated retina and normal
lifespan of six to eight years in captivity.
18
Despite the fact that its eye
is smaller than that of humans (≈8 mm), it has been shown to be a
reliable model of scleral changes in myopia in that it has the same scleral
structure and undergoes similar changes to those found in human
myopes.
19
269 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 269
Gross Scleral Anatomy
The mature sclera forms a spheroidal shell and accounts for some 85% of
the total ocular surface. It is enclosed by the episclera, a loose connective
tissue connecting the sclera with the overlying conjunctiva anteriorly and
generally continuous with the tissue of Tenon’s capsule elsewhere on the
globe. In humans, the sclera gradually thickens from the anterior/equato-
rial regions towards the posterior to reach a maximum thickness of
approximately 1 mm at the posterior pole. Although it is essentially con-
tinuous, the sclera undergoes a number of specific regional modifications
to its gross structure to facilitate rectus muscle insertions, the exit of the
optic nerve fiber bundles at the lamina cribosa, also acting as a conduit for
the central retinal artery and vein and a number of other nerves and ves-
sels en route to anterior ocular structures. Post-natal scleral growth dis-
plays a characteristic anterior–posterior growth axis, as is the case in the
embryonic sclera.
20
Structural organization of the sclera
The sclera is a typical fibrous connective tissue predominantly consisting
of collagen. In mammals, collagen accounts for as much as 90% of the
scleral dry weight and the vast majority of this collagen (as much as 99%)
has been estimated to be type I collagen.
21
However, low levels of other fib-
rillar collagen subtypes, including type III and V have also been reported
in the mammalian sclera, and it is possible to attribute likely roles to each
of these subtypes.
22,11
Scleral collagen fibrils are largely heterologous.
Collagen type V has been found to be important in regulating fibril diam-
eter during fibrillogenesis, as evidenced by the very high collagen type V
concentration in the cornea to produce a uniform collagen fibril diame-
ter.
23
Other reported collagen subtypes of the sclera include types VI and
XII, both of which are considered fibril-associated collagens, and the non-
fibril forming collagen types VIII and XIII.
Proteoglycans are also a major component of the scleral extracellular
matrix. A number of different proteoglycans, all consisting of a genetically
distinct core protein and one or more attached glycosaminoglycan side
chains, have been reported within the mammalian sclera. The mammalian
sclera is rich in hyaluronan, a unique, non-sulphated glycosaminoglycan
that does not associate with a core protein of its own. The sclera also
contains large amounts of dermatan and chondroitin sulphate-based
270 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 270
proteoglycans, particularly the small proteoglycans, decorin, and bigly-
can.
16
These small proteoglycans play an important role in regulating col-
lagen fibril assembly and interaction.
24
In addition to these proteoglycans,
larger proteoglycans, such as aggrecan, are also present in the scleral extra-
cellular matrix. These ‘aggregating’ proteoglycans, with many gly-
cosaminoglycan side chains, are likely to be important in the regulation of
scleral hydration.
Remodelling of the structural matrix of the sclera has been shown to be
mediated by a number of protease enzymes, the most extensively studied
of these being the matrix metalloproteinase (MMP) family. Members of
the gelatinase (MMP-2 and MMP-9) and stromelysin (MMP-3) families
are present in the sclera and are involved in scleral remodelling during
growth and development, since these enzymes are all known to be
involved in the breakdown of collagen.
25–27
Members of the collagenase
family, most notably MMP-1, are also present in the sclera, particularly in
anterior regions of the primate sclera, where they are thought to play a role
in mediating the uveoscleral aqueous outflow pathway.
28
At least two of the
four natural regulators of MMPs, the tissue inhibitors of matrix metallo-
proteinase (TIMPs), are also present in the sclera with reports of TIMP-1
and TIMP-2 in mammalian species.
29,27
Cellular content of the sclera
The structural organization of the sclera is largely reliant on the activity of
the major extracellular matrix-producing cell, the fibroblast. Other cells,
such as melanocytes and the normal transient population of inflammatory
response cells are found in the mammalian sclera and are thought to
derive from the choroid.
30
The scleral fibroblasts, which reside between the
collagen fiber bundle lamellae, are typically described as having a flattened
spindle shape with a flattened nucleus. They have long branching
processes that reach across relatively long distances.
Scleral fibroblasts, like many other cell types, express integrins, such as
the α1, α2, and β1 subtypes.
31
It is likely that clustering of integrin recep-
tors, mediate scleral fibroblast communication with the extracellular
matrix. Cell–cell communication within the scleral extracellular matrix is
mediated through a complex cascade of growth factors, and among those
currently identified within the scleral extracellular matrix are members of
the insulin-like growth factor (IGF-I and IGF-II), transforming growth
factor-beta (TGF-β1, 2 and 3), and fibroblast growth factor (FGF-2)
271 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 271
families.
11
In addition, a high-affinity FGF-2 receptor, FGFR-1, has also
been found to be expressed.
32
More recent studies have demonstrated that,
in addition to expressing the expected collagen, MMP and TIMP subtypes,
fibroblasts express mRNA for the muscarinic receptor subtypes M1, M2,
M3, M4, and M5.
33
Another finding of particular interest in terms of the
biomechanical strength of the sclera is the fact that many scleral fibroblasts
display a myofibroblastic phenotype in that they express α-smooth muscle
actin, organized within the cytoskeletal architecture.
34–36
The sclera is one
of the few structures in the body that has a constant population of
myofribroblasts.
Mechanical properties of the sclera
The biomechanical properties of the sclera are dependent upon a number
of aspects of the scleral extracellular matrix, which can broadly be dis-
cussed within three categories. The first is the scleral structure itself,
namely its thickness, the collagen fibril parameters, namely the organiza-
tion of the collagen fiber bundles and the rate at which the scleral extra-
cellular matrix is turned over. Another important determinant of the
sclera’s mechanical properties is its level of hydration, which, in the
absence of a barrier of epithelial or endothelial cells, is likely to be con-
trolled by the hydrophylic carbohydrates, particularly the glycosaminogly-
cans. The final contributor to the mechanical properties of the sclera is the
scleral fibroblasts themselves, which have recently been shown to display a
myofibroblastic phenotype, thus endowing them with contractile ability.
37
Myofibroblasts are generally defined as highly contractile cells that express
the smooth muscle protein, α-SMA.
34
Typically arising from fibroblast
differentiation, these cells are capable of rapid contractile responses to
imposed tissue stress, thus relieving tension within, and limiting expansion
of, the surrounding matrix.
38,39
These cells also control their local environ-
ment through remodelling of the surrounding extracellular matrix,
strengthening it and relieving cellular stress. Characterization of the
myofibroblast population of the sclera has thus far been limited, although
the presence of myofibroblasts in the sclera has to date been demonstrated
in all of the mammalian species assessed. Studies in human, monkey, tree
shrew, and guinea pig sclera suggest that myofibroblasts comprise a subset
of scleral cells, with one study suggesting an age-dependant increase in the
proportion of myofibroblasts.
34,35
These findings imply that scleral myofi-
broblasts are less prevalent when the eye is growing most rapidly (the
272 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 272
juvenile phase), but that they increase in number as eye growth slows and
reaches its adult size. Interestingly, unlike the normal transience of these
cells in processes like wound healing, the sclera contains a stable popula-
tion of myofibroblasts.
Structural Changes to the Sclera in Myopia
Scleral pathology in high myopia is a major cause, if not the most signifi-
cant factor in the chorioretinal damage that results in the permanent
vision loss experienced by a substantial proportion of high myopes.
Thinning of the sclera, particularly at the posterior pole of the eye, has
long been known to be an important feature of the development of high
myopia in humans. One of the most important clinical consequences of
such thinning is the formation of posterior staphyloma, a condition in
which the thinned sclera becomes ectasic.
40
Staphyloma formation occurs
almost exclusively in the region of the posterior pole of the eye, and thus
can have a catastrophic affect on vision. When compared with the scleral
thickness of age-matched emmetropic eyes, high myopes show a greatly
reduced thickness (up to 50% thinner) at the posterior pole of the eye,
regardless of the presence of staphyloma. Scleral thinning also occurs in
the equatorial and anterior regions of highly myopic human eyes, how-
ever, these changes are less marked than those encountered around the
posterior pole.
Early theories of scleral thinning hypothesized that the existing scleral
tissue was redistributed to cover the surface of the eye as the eye enlarged,
suggesting that the sclera stretched passively to accommodate the expand-
ing eye.
41
However, early histological observations also showed that pro-
found morphological changes, in addition to the thinning, were apparent
in the scleral extracellular matrix. For example, scleral collagen fibril mor-
phology was found to be altered, particularly at the posterior pole of
highly myopic eyes, with a characteristic shift in the fibril diameter distri-
bution, resulting in an increased number of small diameter collagen fib-
rils.
42
In addition, the appearance of what were reported to be ‘stellate’
shaped fibrils was noted, another scleral feature that is suggestive of
pathology as these anomalies were not observed in normal sclerae.
42
In further support of observations that the human sclera undergoes
active remodelling during myopia development, biochemical assays from
highly myopic eyes show markedly reduced amounts of biochemical
273 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 273
markers for collagen and glycosaminoglycans, when compared with the
sclera of emmetropic eyes.
15
Tensile testing of the sclera from highly
myopic human eyes has confirmed that the thinned sclera is less resistant
to deformation than the sclera of emmetropic eyes.
15
The major drawback from studies of post-mortem tissue from highly
myopic human eyes stems from the fact that it is impossible to establish
cause and effect of the scleral pathology in high myopia. Specifically, it is
not possible to say whether the biochemical changes encountered in the
sclera of human high myopes occur prior to, thus implicating them in the
cause of scleral thinning and stretch, or whether they are a consequence of
the scleral thinning. Such questions are more directly addressed in studies
utilizing animal models of myopia, and the results of these studies have
enabled us to answer many important questions raised from observations
of the sclera of humans with high myopia.
Development of structural and ultrastructural
scleral changes in myopia
A major feature of scleral thinning in human myopia is that it is largely
confined to the posterior pole of the eye (Fig. 1A). Obviously, a major
requirement of any appropriate model to elucidate mechanisms in human
myopia is that it should demonstrate this regional change.
19
The most
remarkable feature of this scleral thinning is the fact that it occurs very
rapidly in response to the onset of myopia development. Indeed, it has
been found that the posterior sclera thins by some 20% over the first
12 days of myopia development in young tree shrews (Fig. 1B). This time
period represents the early phase of myopia development, during which
some 12 dioptres of relative axial myopia are induced. This reduction in
scleral thickness progresses slowly over the next three to eight months,
representing the later phase of myopia development, despite the fact that
these eyes continue to display evidence of myopia progression (up to 20
dioptres or an increase in axial eye size of ~7%).
19
Analysis of the dry weight of the sclera has demonstrated that the cause
of scelral thinning in myopia is due to the actual loss of scleral tissue as
opposed to passive stretch of the sclera. The rate of loss of scleral tissue
corresponds closely with the time course of scleral thickness changes at the
posterior pole of the myopic tree shrew eye and demonstrates that poste-
rior scleral tissue is lost rapidly. Significant decreases in scleral dry weight
are apparent at the posterior pole (>5%, p < 0.05) after only five days of
274 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 274
myopia induction in young tree shrews (Figs. 2A and B), representing the
initial stages of myopia development.
43
This tissue loss continues to occur
rapidly over the initial 12 days of myopia development, accounting for
17% reduction of posterior scleral dry weight (Fig. 2B). Over the next
three to eight months of myopia progression the continued loss of scleral
275 Changes to the Sclera in Myopia
Figure 1. Thinning of the posterior sclera in mammalian eyes with progressive high myopia.
A. Light micrographs of toluidine blue-stained transverse-sections of the posterior sclera of
a highly myopic and fellow control eye of a tree shrew, following eight months of myopia
progression. B. Mean posterior scleral thickness in the myopic, fellow control and
age-matched normal eyes of tree shrews following 12 days (n = 2 normal and n = 5 myopic)
or 6–20 months (n = 4 each group) of myopia progression. Error bars are 1 SEM. **p < 0.01,
*p < 0.05 by paired t-test. (Reproduced with permission from McBrien & Gentle 2003,
Copyright Elsevier Science Ltd.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 275
276 N.A. McBrien
Figure 2. Scleral tissue loss during the progression of high myopia is most rapid during the early
stages of myopia progression. A. Absolute dry weight of the posterior sclera (5 mm button
centered on the posterior pole) in myopic, fellow control, and age-matched normal eyes fol-
lowing 12 days (n = 8 normal and n = 15 myopic) or 6–8 months (n = 4 normal and n = 15
myopic) of myopia progression. (Updated from McBrien et al., 2001a © Association for
Research in Vision and Ophthalmology.) B. Relative difference in anterior, posterior, and total
scleral dry weight between myopic and fellow control eyes of tree shrews following five days
(n = 13), 12 days (n = 15) and >6 months (n = 15) of myopia progression. Normal animals
(n = 16) were age-matched to five-day animals. C. Interocular differences in the posterior
scleral dry weight with length of myopia induction in tree shrews. n’s as for Fig. B. Error
bars are 1 SEM. **p < 0.01, *p < 0.05 by paired t-test. (Reproduced with permission from
McBrien & Gentle 2003, Copyright Elsevier Science Ltd.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 276
tissue is less marked (Fig. 2C).
19
These studies demonstrate there is a net
tissue loss from the whole sclera of up to 7% of dry weight, unequivocally
demonstrating that tissue is lost, rather than just re-distributed, during the
development of myopia (Fig. 2B). Such a finding highlights the probabil-
ity that biochemical changes are a precursor to changes in the material
properties of the sclera, and ultimately, to myopia development.
In conjunction with the tissue loss observed in the tree shrew model,
characteristic changes in collagen fibril diameter are also apparent in the
sclera of highly myopic eyes, consistent with the findings in humans and
monkeys. However, fibril diameter changes are only detectable a consid-
erable time after the main changes in scleral thickness and tissue loss have
occurred. Studies demonstrate that the scleral fibril diameter distribution
profiles remain similar in myopic eyes to those in the sclera of normal eyes
during the early phases of myopia development (Fig. 3A). This is despite
major changes in scleral thickness and dry weight having occurred in those
same eyes.
19
However, after longer periods of myopia development (three
months), a reduction in median collagen fibril diameter is found at the
posterior pole of myopic eyes (Fig. 3B). This change is most marked in
the outer scleral fiber bundles, which is consistent with the embryologi-
cal observation that the outer fiber bundles are the last to mature.
20
By six
to eight months of myopia development there is a highly significant
reduction in collagen fibril diameter across the scleral thickness, with the
greatest reduction in diameter, around 35% (Fig. 3C), apparent in the
outer layers of the sclera.
19
As in humans, these changes are mainly local-
ized to the posterior pole of the eye, although changes also occur in equa-
torial regions of the sclera, however, these are less dramatic. The shift in
fibril diameter in myopic eyes results in a reduction in the gradient in
fibril diameter across the scleral thickness, and it is interesting to note
that this gradient is virtually absent in eyes with longstanding high
myopia (Fig. 4).
19
Scleral pathology and staphyloma
Data collected during the long-term development of myopia suggests
that although the sclera thins rapidly and alters its material properties
during the early stages, shifts in collagen fibril diameter are not apparent
until later in myopia development. Recent data indicates that a shift
in the ratio of type V collagen to type I collagen production during
the early stages of myopia development may ultimately contribute to
277 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 277
278 N.A. McBrien
Figure 3. Median scleral fibril diameter as a function of myopia progression. A. 12 days of
myopia progression. n = 3 animals. B. Three months of myopia progression. n = 1 animal.
C. Nine months of myopia progression. n = 3 animals. Approximately 1200 fibrils were sur-
veyed per eye in each animal. (Reproduced with permission from McBrien & Gentle 2003,
Copyright Elsevier Science Ltd.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 278
279 Changes to the Sclera in Myopia
staphyloma development in later life, through the progressive formation
of more small diameter collagen fibrils. Furthermore, these changes are
more localized to the posterior region of the eye. In humans, identical
fibril diameter changes are reported in staphylomatous eyes. It should be
Figure 4. Reduction in the trans-scleral collagen fibril diameter gradient in eyes with progressive
myopia. A. Electron micrographs show transverse sections through collagen fibrils in
the defined inner, middle, and outer posterior sclera of highly myopic, fellow control and age-
matched normal eyes of 9–9.5 month-old tree shrews. B. Graphic representation of the trans-
scleral collagen fibril diameter gradient in highly myopic (n = 3), fellow control (n = 3), and
age-matched normal (n = 8) eyes of 9–9.5 month-old tree shrews. (Reproduced with
permission from McBrien & Gentle 2003, Copyright Elsevier Science Ltd.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 279
noted that staphyloma formation, although also related to eye size, is
often a later occurrence in human high myopes.
44,40
Our knowledge of
the biomechanical properties of the sclera now dictates that these
markedly thinned regional areas, with reduced glycosaminoglycan con-
tent and small collagen fibrils, have a reduced resistance to intraocular
pressure. Furthermore, the relatively annular organization of these bun-
dles of collagen, around the optic nerve insertion and macular area,
result in a local area that is particularly susceptible to the expansive force
of the normal intraocular pressure. Other scleral regions, where collagen
fiber bundle organization is relatively anisotropic, would be relatively
protected against such an occurrence. Indeed, the anatomical area
described above corresponds remarkably well with the area of formation
of by far the most common type of staphyloma, the type I posterior
staphyloma.
40
The data presented in this review are consistent with the
hypothesis that the localized thinning of the sclera and glycosaminogly-
can loss, in conjunction with the scleral collagen fibril diameter changes,
interact with the localized orientation of fibril bundles to result in the
development of staphyloma.
Biochemical Changes in the Sclera of Myopic Eyes
The marked changes in structure reported in the sclera of eyes with
high myopia, and the evidence that this is occurring due to tissue loss, indi-
cate that changes occur in the biochemistry of the sclera. Studies to test this
hypothesis have broadly concentrated on investigating three specific
aspects of the biochemical processes in the sclera, namely: i) the biochem-
istry of the structural components of the sclera; ii) the regulation of the
degradative processes in the sclera; and iii) the cellular changes that
ultimately regulate the structural and biochemical alterations.
Structural biochemistry of the sclera in myopia
The majority of investigations into the biochemistry of scleral structure in
myopia have concentrated on the main structural components, namely
collagen and proteoglycans. The importance of scleral collagen bio-
chemistry in the myopic eye is illustrated by the results of a study that pre-
vented tropocollagen cross-linking in the sclera, through the use of
beta-aminopropionitrile, which inhibits lysyl oxidase activity.
18
The
280 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 280
treatment was found to result in a significant increase in myopia develop-
ment and significantly increased scleral thinning in the posterior region of
form-deprived myopic eyes, indicating that altered scleral biochemistry
made the eye markedly more susceptible to the normal expansive intraoc-
ular forces. However, there was found to be no observable effect on eye
growth in normal eyes, indicating the importance of other underlying
changes in scleral properties in myopia development.
Studies in tree shrews and humans have found a reduced collagen con-
tent at the posterior pole of the sclera of highly myopic eyes.
15,45
Recently,
studies have demonstrated reductions of up to 35% in collagen type I
mRNA expression in myopic eyes, also suggesting that collagen accumula-
tion in the sclera is reduced due to a decrease in production.
46,47
Furthermore, confirmation that the incorporation of the radiolabelled
collagen precursor, [
3
H]-proline, was reduced by a similar magnitude was
demonstrated when data was normalized to the extractable collagen con-
tent of the sclera, confirming that collagen synthesis is reduced early in
myopia development.
47
Subsequent investigations demonstrated that
[
3
H]-proline elimination from the sclera was enhanced in a magnitude
consistent with the previously reported scleral dry weight changes.
47
The
above data further strengthens the argument that scleral dry weight loss in
myopia development is primarily a result of reduced collagen accumula-
tion. Collectively, one can conclude from the above data that reduced col-
lagen accumulation in the posterior sclera of myopic eyes is driven by both
reduced collagen synthesis and increased collagen degradation (see later).
Furthermore, these studies demonstrate that the reduction in collagen
accumulation is greatest during the early stages of myopia development,
which is consistent with the time dependent response of scleral thinning
and scleral tissue (dry weight) loss.
19,43
A recent study investigated scleral expression of the quantitatively
minor fibrillar collagen subtypes III and V. Type V collagen, in particular,
is important in the control of fibril diameter in the cornea, and therefore
represents a candidate for the regulation of the collagen diameter changes
found in the sclera of myopic eyes. Studies have found that although col-
lagen type I mRNA expression is reduced in eyes developing myopia, there
are no changes in collagen types III and V expression between myopic and
control eyes.
47
The reduced type I collagen production and stable type III
and V levels result in a 20% increase in the type V/type I and type III/type
I collagen ratio. Thus, in relative terms, newly synthesised fibrils in myopic
eyes may contain 20% more type V collagen. Previous reports in the
281 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 281
literature on cornea suggest that such a magnitude of change is sufficient
to bring about a 40% reduction in collagen fibril diameter.
48
This reduc-
tion is similar to the magnitude of the fibril diameter change encountered
in the outer scleral layers of longer-term myopic eyes (around 35%).
19
The glycosaminoglycan component of the scleral proteoglycans has been
investigated extensively as a marker for changes in scleral biochemistry dur-
ing myopia development. Glycosaminoglycan synthesis is reduced in the
sclera of a number of mammalian models of myopia development
(Fig. 5).
49,50
This is consistent with findings that overall glycosaminoglycan
content is also reduced in human and tree shrew eyes.
18,45
Altered synthesis
is of significance given the importance of the high-density negative charge
on glycosaminoglycans in determining the mechanical properties of a tis-
sue. Studies have shown that reduced GAG synthesis occurs in the earliest
stages of myopia development and is sustained as the myopia develops.
29,43
Reduced glycosaminoglycan synthesis and content usually implies there
is a concomitant reduction in proteoglycan production in a given tissue
system. However, investigators have paradoxically found no change in the
expression of the core protein mRNA of decorin, which is one of the more
important proteoglycans of the mammalian sclera.
27
It is argued that this
suggests glycosaminoglycan side chains may be shorter, or the occupancy
of their sulphation sites reduced, in eyes developing myopia. Regardless of
282 N.A. McBrien
Figure 5. Glycosaminoglycan synthesis in the sclera of myopic eyes. GAG synthesis is reduced in
the anterior, posterior, and total sclera of tree shrews following five days of myopia
progression. n = 5 animals in each group. Error bars are 1 SEM. **p < 0.01, *p < 0.05.
(Reproduced with permission from McBrien and Gentle, 2003 © Elsevier Science Ltd.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 282
whether proteoglycan content is reduced in conjunction with gly-
cosaminoglycan content, the important role that the negative charge den-
sity plays in the control of extracellular matrix mechanics
51
implicates
glycosaminoglycans in the mediation of the earliest biomechanical
changes in myopic eyes. These observations are consistent with the
hypothesis that scleral glycosaminoglycan content is a major factor under-
lying the early changes in the visco-elastic properties of the sclera that are
characteristic of myopic eyes.
Degradative processes in the sclera of myopic eyes
Studies have shown a change in the activity of collagen degrading enzymes
in the sclera of myopic eyes. Matrix metalloproteinase-2 (MMP-2) has
been shown to be important both in the degradation of native collagen
fibrils and in the further degradation of their breakdown products.
52
The
enzyme is secreted in a pro-enzyme, or latent, form and is then activated
at the cell membrane by cleavage of the latency-conferring terminus of the
pro-enzyme.
53
Studies in mammalian models have shown that MMP-2
activity is increased in the sclera of myopic eyes (Fig. 6A).
26
Protein analy-
ses of the latent and active forms of the enzyme show a supplementation
of the latent pools of the enzyme in the sclera, but the major change dur-
ing myopia development is a three-fold increase in levels of the active form
of the enzyme (Fig. 6B).
26
Subsequent studies of MMP-2 confirm a small
increase in the mRNA expression of latent MMP-2.
27
However, this
increase does not match the relative increase in levels of active MMP-2 in
the sclera of myopic eyes, indicating the major change is related to activa-
tion of latent MMP-2 and not increased production of MMP-2 (Fig. 6C).
Findings to date are consistent with the hypothesis that increased
degradative activity, and possibly net reduction in the inhibition of this
activity, drives the scleral thinning and tissue loss seen in myopic eyes.
However, it should be remembered that biochemical data also indicates
there is a concomitant decrease in the synthesis of new structural material
in the extracellular matrix, which contributes to the reduced accumulation
of the scleral matrix.
Cellular changes in the sclera in myopia
Reduced DNA synthesis accompanies tissue remodelling in the sclera of
myopic eyes, implicating cellular changes of the scleral fibroblasts, which
283 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 283
284 N.A. McBrien
Figure 6. MMP-2 activity in myopia. Scleral MMP-2 activity is increased during myopia devel-
opment and decreased during recovery from induced myopia, particularly at the posterior
pole of the eye. A. Gelatin zymography showing levels of latent and active MMP-2 in titra-
tions of extracted protein from the posterior sclera of highly myopic, recovering and fellow
control eyes of tree shrews, relative to titrations of standards. B. Graphic representation of
mean levels of latent and active MMP-2 activity in the posterior sclera of highly myopic,
recovering and fellow control eyes of tree shrews, relative to titrations of standards.
B. Graphic representation of mean levels of latent and active MMP-2 activity in the poste-
rior sclera of highly myopic, recovering and fellow control eyes of tree shrews following five
days of myopia progression or five days of myopia progression followed by three days of
recovery. C. Active-latent MMP-2 ratio in the sclera of highly myopic, recovering, and fellow
control eyes of tree shrews following five days of myopia progression or five days of myopia
progression followed by three days of recovery. n = 6 animals in each group. Error bars are
1 SEM. **p < 0.01, *p < 0.05. (Adapted with permission from Guggenheim and McBrien,
1996 © Association for Research in Vision and Ophthalmology.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 284
ultimately regulate the process of scleral remodelling.
54
However, these
studies also report that total DNA content of the sclera is not significantly
altered after periods of myopia development. Thus, although DNA syn-
thesis is reduced in myopic eyes, there is no net change in the number of
scleral fibroblasts.
45,54
There is, however, found to be an increase in the
number of scleral cells per unit dry weight in the sclera of myopic eyes,
which might be expected if cell numbers remain the same but matrix tis-
sue is lost. One possible explanation is that the reduced overall metabolic
demand on the scleral cells of myopic eyes results in a concurrent reduc-
tion in the number of cells committing to apoptosis, thus offsetting the
reduced number of mitotic events in the sclera.
54
Biomechanical Changes in the Sclera of Myopic Eyes
As a major component influencing the mechanical properties of any bio-
logical tissue is thickness, one would anticipate changes in the biome-
chanical strength of the sclera based solely on the reported structural
changes in myopia.
19
Indeed, studies have shown that strips of scleral tis-
sue from myopic human and tree shrew eyes have a greater initial extensi-
bility (elasticity) in response to an imposed load than control tissues from
normal eyes, and this occurs in both the posterior sclera and equatorial
sclera.
18,38,55
This difference is predominantly a result of the thinner sclera
of the myopic eye, rather than a change in the particular properties of the
sclera, since the modulus of elasticity was found to be similar between
myopic and control eyes. Importantly, however, finite element modelling,
using the scleral properties determined in this experiment, suggested that
this simple elastic stretch could account for no more than 20% of the
increase in eye size in myopia.
38
This finding demonstrates that scleral
thinning alone cannot account for the majority of ocular enlargement that
occurs in myopic eyes and strongly implicates there is a significant contri-
bution from other material properties of the sclera in facilitating changes
in eye size during myopia development.
More recent studies have investigated the visco-elastic, time-dependent
response (creep) of the sclera from myopic tree shrew eyes to a constant
load over time. The data demonstrated that scleral creep rates were higher
in samples from the posterior sclera of myopic eyes, even when correction
is made for the cross-sectional area of the tissue samples (Figs. 7A and B).
56
285 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 285
Findings from equatorial scleral samples in tree shrews also show
increased creep rates in myopic eyes.
56
This indicates that the visco-elastic
properties of the sclera are indeed markedly altered in myopic eyes.
55,56
These changes occur as early as four days into the process of myopia devel-
opment, when the sclera displays a creep rate in excess of 200% that of
control eyes.
55
Of particular significance is the finding that there is a strong
correlation between the actual degree of myopia induced and the creep
properties of the mammalian sclera (Figs. 7C and D).
56
These findings
demonstrate a direct relationship between the degree of myopia and the
material properties of the sclera in mammalian eyes. The data also indi-
cates that in an eye with a weakened sclera due to a change in material
properties and given sufficient time, physiological intraocular pressures
may be sufficient to induce continuing progressive ocular enlargement.
The data from ultrastructural and biomechanical studies of the sclera
from myopic eyes consistently demonstrate that, in early myopia develop-
ment, scleral tissue loss rapidly results in scleral thinning. This scleral thin-
ning contributes to, but cannot account for, the majority of the early
changes in eye size. Furthermore, collagen fibril diameter, a structural ele-
ment that influences the elastic modulus of the collagen matrix in a num-
ber of tissues, is only found to be reduced after myopia has been present
for an extended period. These findings demonstrate that changes in other
properties of the scleral matrix, such as glycosaminoglycan charge density
and/or tissue hydration, may be more important in the early alterations of
scleral biomechanical properties found in myopic eyes.
Unlike data from the in vitro studies described earlier, changes in axial
length act as a surrogate for the extensibility of the eye, and allow esti-
mates of both the elastic and creep behavior of the eye to be determined
in vivo. When intraocular pressure is increased, both avian and mam-
malian eyes exhibit an initial elastic response to the imposed intraocular
pressure rise, followed in the avian eye by a gradual, creep extension
(Fig. 8A).
35
However, in the mammalian eye, this initial elastic enlarge-
ment of the eye is subsequently offset by a gradual shortening of the eye,
yielding negative creep values (eye gets shorter). When the intraocular
pressure was returned to normal, the eye had become shorter than its
original starting value (Fig. 8B). The rapidity of the shortening response
(less than one hour) cannot be explained in terms of scleral matrix
remodelling, implicating the scleral cells themselves in the physical
286 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 286
287 Changes to the Sclera in Myopia
Figure 7. Scleral creep extension curves for samples from myopic, fellow control, and normal
eyes, and the relation between scleral creep rates and vitreous chamber elongation and
myopia progression. A. Complete scleral creep extension vs. time curves from a highly
myopic and fellow control eye of a tree shrew, following 12 days of myopia progression.
B. Averaged creep extension vs. time curves from highly myopic, fellow control, and age-
matched normal eyes in tree shrews following 12 days of myopia development. For each
sample, creep extension is the percentage of sample length at 300 seconds after the
application of the 5 g load. n = 10 animals in each group. C. Interocular difference in vit-
reous chamber depth vs. interocular difference in creep extensibility between highly
myopic and fellow control eyes of tree shrews following 12 days of myopia progression.
r = 0.75, p < 0.05. n = 10 animals. D. Interocular difference in refractive error vs. interoc-
ular difference in creep extensibility between highly myopic and fellow control eyes of
tree shrews following 12 days of myopia progression. r = 0.79, p < 0.01. n = 10 animals.
(Reproduced with permission from Phillips et al., 2000 © Association for Research in
Vision and Ophthalmology.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 287
288 N.A. McBrien
Figure 8. The effect of intraocular pressure elevation on axial length. A. Change in the axial eye
length of 10 normal chick eyes on raising IOP to 100 mm Hg. Initial values of axial length
at 15 mm Hg are shown at time = −5 min. IOP was raised to 100 mm Hg at Time = 0 and
remained at 100 mm Hg for one hour (horizontal bar) after which it was returned to
15 mm Hg. In all chick eyes axial length increased during the period of elevated pressure.
The mean curve is shown as open circles. B. Change in the axial eye length of 10 normal
tree shrew eyes on raising IOP to 100 mm Hg for one hour. Experimental procedures were
the same as those for chick eyes. However, in all tree shrew eyes, axial length progressively
decreased during the period of elevated pressure. The mean curve is shown as filled circles.
(Reproduced with permission from Phillips and McBrien, 2004 © Association for Research
in Vision and Ophthalmology.)
process of ocular shortening. Further investigation of scleral cells in the
mammalian sclera via immunohistochemistry showed the sclera to
contain a subset of cells that express a protein known as alpha-smooth
muscle actin (α-SMA), namely myofibroblasts.
35
Given that α-SMA is
typically found in muscles, this finding has led to the hypothesis that
the scleral cells have an active role in the mechanical properties of the
mammalian sclera, and that this may be of importance in a number of
physiological and pathological ocular functions.
TGF-β is of primary importance in the regulation of extracellular
matrix turnover and the three mammalian isoforms of TGF-β have been
demonstrated to be present in the sclera and to regulate collagen produc-
tion via fibroblasts.
57
Furthermore, TGF-β isoform changes in myopia
development occur within 24 hours of the initiation of myopia develop-
ment and have been linked to the altered regulation of ECM production
found in the sclera of eyes developing myopia.
57
mRNA expression levels
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 288
of the TGF-B isoforms in the sclera are differentially reduced in an iso-
form- and time-dependent manner possibly reflecting isoform-specific
roles in the remodelling of the scleral ECM at different stages of myopia
development (see Fig. 9).
Regulators of scleral myofibroblast differentiation
Fibroblast to myofibroblast differentiation is a complex process, with a
number of signalling factors important in the fibroblast moving through
the proto-myofibroblast to mature myofibroblast stage.
58
However, at a
basic level the process is initiated either by induced stress on the cell and
matrix, or through stimulation with cell signalling factors, among the
289 Changes to the Sclera in Myopia
Figure 9. Alterations in TGF-b isoform gene expression during myopia development. Monocular
deprivation of form vision was used to induce myopia in tree shrews and TGF-b isoform
expression was quantified after one (A, C) and five (B, D) days deprivation. Copies of indi-
vidual isoforms were quantified in scleral samples (n = 6) with reference to an external stan-
dard, and were expressed per 1000 copies of the housekeeping gene, HPRT (A, B). Data is
also presented as the percentage difference in gene expression (treated eye – control eye) ±
SEM (C, D).* indicates a statistically significant result. (Reproduced with permission from
Jobling et al., 2004 © The American Society for Biochemistry and Molecular Biology, Inc.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 289
290 N.A. McBrien
most important of which is the cytokine transforming growth factor beta
(TGF-β).
58
The sclera, itself, is under constant and fluctuating stress due
to intraocular pressure, while TGF-β is present within the scleral matrix
and has been implicated in the remodelling that occurs during myopia
development. In vitro cell culture studies using attached or stressed colla-
gen gels have shown that scleral myofibroblasts are readily formed by
increasing matrix stress. Similarly, the addition of TGF-β to scleral cell
cultures brings about a rapid differentiation of fibroblasts into α-SMA-
expressing myofibroblasts (Fig. 10).
37
Careful assessment of the structural
proteins within the cell cytoplasm shows that ‘stress fibers’ have
developed within the cell that typically orient themselves parallel to the
imposed stress.
37
Myofibroblast-extracellular matrix interactions
Myofibroblasts are capable of modifying their extracellular environment
both through contraction and the production of new extracellular matrix.
Once formed, myofibroblasts produce collagen, proteoglycans and many
other constituents and regulators of the extracellular matrix, in order to
maintain or repair their extracellular environment. For this reason, myofi-
broblasts must be continually receiving information on the surrounding
matrix. The major significance of this direct cell-matrix interaction is
twofold. Firstly, the cell is in a position to immediately sense any changes
in the stress experienced by the extracellular matrix, and thus be in a posi-
tion to change its production and regulation of the extracellular matrix
accordingly. Secondly, the cell is in a position to physically respond to any
imposed stresses, via contraction of its surrounding matrix.
Data from many different tissue systems show that extracellular matrix-
producing cells, such as myofibroblasts, are closely related to their matrix
through a variety of cell-matrix adhesion molecules. On the outside of the
cell these adhesion molecules act as receptors, binding to various aspects
of the extracellular matrix, such as collagen.
59
These cell adhesion mole-
cules also span the cell membrane and join, internally, to the cytoskeleton
of the cell, forming a complete bridge between the extracellular matrix and
the actin of the internal framework of the cell.
59
The integrin family of
receptors are perhaps the most important cell adhesion molecules in
extracellular matrices such as the sclera. Collagen-binding integrins have
been demonstrated on scleral cells.
31
Of further interest, integrin gene
expression has been shown to be altered in eyes developing myopia,
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 290
291 Changes to the Sclera in Myopia
Figure 10. TGF-β regulation of scleral fibroblast differentiation. Cultured scleral fibroblasts
were incubated with (C) or without (A) TGF-β for five days. The expression of the myofi-
broblast-marker, α-SMA was assessed using fluorescent immunocytochemistry (×400).
Cells observed at higher magnification (×630; E) show α-SMA-containing stress fibers.
The respective negative controls are included in panels B and D, and bars represent
50 µm. (Reproduced with permission from McBrien et al., 2009 © American Academy of
Optometry.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 291
suggesting that the cell-matrix bond is altered in myopic eyes.
31
Such a
reduction in cell-matrix contact would have implications for the biome-
chanical response of the sclera.
Cellular and matrix contributions to altered scleral
biomechanics and myopia
From the above discussion, scleral myofibroblasts must be considered an
integral part of the biochemical and biomechanical response of the sclera,
both in normal and abnormal eye growth. These cells certainly contribute
to the matrix changes widely reported in the sclera of eyes developing
myopia,
19
and their mechanical interaction with the matrix, together with
their contractile capability, indicate a mechanism whereby the sclera may
control its elastic response to short term changes in stress, such as during
fluctuations in intraocular pressure due to cardiac cycle, respiration, and
eye movement.
A proposed model for the role of scleral myofibroblasts in myopic eye
growth, incorporating the current data, is shown in Fig. 11. A retino-
scleral signalling mechanism
43
initiates a process of scleral tissue loss,
partly due to reduced synthesis of extracellular matrix components and
partly a result of accelerated degradation.
60
As the sclera thins, a series of
gene expression changes are initiated amongst the scleral myofibroblasts,
which results in the changes in the collagenous matrix that subsequently
manifest in myopia development, such as reduced diameter of collagen
fibrils.
60
Changes in scleral thickness and the material properties of the
sclera increase the capacity of the sclera to creep under normal intraocu-
lar pressure, and this process also increases the stresses present within the
matrix, and therefore on the myofibroblasts. Downregulation of integrin
expression early on in the process of myopia development
57
represents a
mechanism whereby myofibroblasts disconnect from the scleral matrix,
releasing the cells’ mechanical influence on the matrix and enhancing the
capacity of the sclera to creep and the eye to grow. Such a response may
also reflect a protective mechanism in response to the stresses the fibro-
blast is experiencing. These scleral myofibroblasts may try to reconnect
with the creeping matrix, perhaps enhancing their contractile capabilities
in doing so. Similarly, they may remain disconnected from the matrix,
de-differentiating to fibroblasts, due to their reduced experience of the
stress in the matrix, and allowing further increase in the creep capacity of
the sclera (Fig. 11).
292 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 292
The biomechanical properties of the sclera are critical in maintaining
normal ocular development. Alterations in these properties, such as those
seen during myopia development, produce concurrent alterations in eye
size. While remodelling to the scleral matrix was considered to be the sole
determinant of biomechanical change, recent data has highlighted
the important role of scleral cells, particularly scleral myofibroblasts.
While our current knowledge of the role of scleral myofibroblasts in nor-
mal and abnormal eye growth is incomplete, proper identification of the
factors involved in scleral weakening and subsequent increased eye size
293 Changes to the Sclera in Myopia
Figure 11. Proposed schematic model of the role of scleral myofibroblast cells in the biochem-
ical and biomechanical remodelling that facilitates the scleral changes that occur during
myopia development and progression, based on current evidence. See text for details.
(Reproduced with permission from McBrien et al., 2009 © American Academy of
Optometry.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 293
will enable more refined treatments to be devised than currently available
to reduce the impact of the biomechanical weakening of the sclera in high
myopia on visual function.
Scleral Changes in Myopia are Reversible
To date we have concentrated on the role of the sclera in the develop-
ment of myopia and the pathological complications consequent to the
axial elongation of the eye. However, although it is has not yet been
explicitly discussed, there is substantive evidence to demonstrate the
vital role that visual information plays in the control of this scleral
remodelling. Indeed, there is strong evidence to show that scleral thin-
ning and loss of tissue in myopia are reversible in paradigms resulting in
recovery from axial myopia, and as such, provide insight into potential
treatment approaches.
Eye growth regulation during recovery from induced myopia
Recovery from induced myopia in experimental models of refractive error
can be considered a manifestation of the innate emmetropization process.
In essence, once myopia is induced, either through monocular deprivation
or using a negative lens, removal of the inductive device results in the eye
altering its growth pattern to eliminate the induced refractive error. It is
assumed that this process occurs through the recognition of myopic blur
by the retina, on removal of the occluder or negative lens, and subsequent
modification of the ocular growth rate to compensate. This essentially can
be considered an emmetropization response as the eye alters its growth
rate to reduce the defocus. In the avian model of myopia, recovery occurs
initially through thickening of the choroid. This moves the retina physi-
cally forward and reduces the amount of defocus by bringing the plane of
the photoreceptors closer to the image plane. This is followed by a reduc-
tion in the growth rate of the sclera until the axial eye length is again
coordinated with the optical power of the eye at which time the choroid
returns to its normal thickness as does the scleral growth rate.
61
In the
mammalian and primate models of myopia, however, recovery involves
only a minor contribution from changes in choroidal thickness.
43,62
Such findings indicate that scleral changes are the principal factor in the
recovery process in mammalian species.
294 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 294
As discussed earlier, scleral glycosaminoglycan synthesis is reduced dur-
ing myopia development, however, on removal of the occluder/lens there
is a rapid rise in glycosaminoglycan synthesis, such that, within 24 hours
of recovery, glycosaminoglycan synthesis levels have returned to control
eye levels (Fig. 12A).
43
At this stage there is no significant change in the
degree of myopia or in the length of the eye, however, after three days of
recovery, the eye has started to shorten and reduce its refractive error. By
this time there is found to be a significant increase in scleral glycosamino-
glycan synthesis relative to the control eye. Between days 3 and 5 of recov-
ery, the most marked reduction in refractive error occurs, primarily
through a reduction in the axial length of the eye. Importantly, the period
of peak glycosaminoglycan synthesis precedes the most rapid period of eye
size change, suggesting that the scleral remodelling may lead to the
changes in eye size. Thereafter, the magnitude of increase in glycosamino-
glycan synthesis begins to diminish, and by the time the relative refractive
error is eliminated (around seven to nine days), glycosaminoglycan syn-
thesis is returning to control eye levels (Fig. 12A). There is also a replace-
ment of the tissue that is lost during the development of myopia and this
tissue mass briefly exceeds that of the control eye when recovery is
achieved.
43
Other studies have shown that DNA synthesis is also upregu-
lated during the recovery process in the tree shrew (Fig. 12B) and there is
also a relative reduction in the levels of MMP-2 and TIMP-2 mRNA and
protein production (see Fig. 6). This results in an overall reduction in
active levels of MMP-2 in the sclera, which is consistent with the increase
in scleral dry weight observed.
26,29
Such findings are important in demon-
strating that the direction of eye growth is specifically dependent on the
direction of regulation of scleral remodelling.
Biochemical studies show that the major replacement of scleral tissue
during recovery occurs at the posterior pole of the eye, and that the major
increase in glycosaminoglycan synthesis also occurs in this region.
Although this might be expected, as this is the location where most of the
scleral tissue is lost during myopia development, there is evidence of some
remodelling of the equatorial regions of the sclera during recovery from
axial myopia.
43
The significance of changes in the equatorial region of the
sclera during recovery has not been fully elucidated, however, it is possible
that it plays a role in the shortening of the eye that occurs in recovery.
Recent studies have confirmed the importance of visual information in
the control of scleral remodelling in myopia. Studies have established that
accurate correction of induced myopia, simulating correction of myopia
295 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 295
296 N.A. McBrien
Figure 12. Changes in anterior and posterior scleral glycosaminoglycan and DNA synthesis
during the development of, and recovery from, myopia in tree shrew. A. Interocular dif-
ference in glycosaminoglycan synthesis in the anterior and posterior sclera of tree shrew
eyes, following five days of myopia development and five days of myopia development
followed by one, three, five, seven, or nine days of recovery. (Reproduced with permis-
sion from McBrien et al., 2000 © Association for Research in Vision and Ophthalmology.)
B. Interocular difference in DNA synthesis in the anterior and posterior sclera of tree
shrew eyes, following five days of myopia development and five days of myopia devel-
opment followed by three days of recovery from induced myopia. (Reproduced with
permission from Gentle and McBrien, 1999.) n = 5 animals in each group. Error bars are
1 SEM. **p < 0.01, *p < 0.05.
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 296
297 Changes to the Sclera in Myopia
Figure 13. Correction of induced myopia with eyeglass lenses results in the prevention of recov-
ery from induced myopia in tree shrews. Corrective lenses also prevent the scleral changes
in glycosaminoglycan synthesis that are characteristic of the recovery from induced myopia.
A. Interocular difference in refractive error between treated and control eyes of animals fol-
lowing five days of myopia progression or five days of myopia progression followed by five
days of recovery from induced myopia, either with or without corrective lenses. Normal eyes
were age-matched to the five-day myopia animals. B. Interocular difference in vitreous cham-
ber depth between treated and control eyes of animals following five days of myopia pro-
gression or five days of myopia progression followed by five days of recovery from induced
myopia, either with or without corrective lenses. Normal eyes were age-matched to the five-
day myopia animals. C. Interocular difference in scleral glycosaminoglycan synthesis between
treated and control eyes of animals following five days of myopia progression or five days of
myopia progression followed by five days of recovery from induced myopia, either with or
without corrective lenses. Normal eyes were age-matched to the five-day myopia animals.
n = 5 animals per group. Error bars are 1 SEM. **p < 0.01, *p < 0.05. (Reproduced with
permission from McBrien et al., 1999 © American Academy of Optometry.)
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 297
in humans by the wearing of eyeglasses or contact lenses for myopia, pre-
vents the recovery response.
49,63
In contrast to the animals allowed to
recover from induced myopia, animals wearing lenses that fully corrected
the induced myopia did not recover and their sclerae retained a ‘myopic’
phenotype of reduced glycosaminoglycan synthesis (Fig. 13) and reduced
thickness.
49
This phenotype persisted over an extended period of lens
wear and beyond the period during which eye growth was found to sta-
bilize. Despite the fact the visual image is immediately placed in focus on
the retina, and that the eye has returned to a stable growth rate, the sclera
retains a myopic biochemical phenotype for a substantial period of time.
Such a finding has important implications for the correction of human
myopia.
Summary and Conclusions
This review chapter has interpretated the implications of current research
findings in humans and in animal models to highlight the role of the sclera
in myopia development and progression. In applying current knowledge
of the development, structure, and function of the sclera, the ways in
which the scleral ultrastructure, and the related biomechanical properties,
are altered in myopia development and ultimately lead to the pathological
changes seen in human high myopia have been highlighted. This review
has provided an updated model of scleral thinning in highly myopic eyes.
From the current research evidence, the feasibility of treatments for
myopia-related scleral pathology to prevent the aberrant remodelling
process in the sclera, thus preventing scleral tissue loss, thinning, and the
long term development of a weakened scleral collagen fibril matrix are
now an option to control or ameliorate the pathophysiology associated
with high myopia.
Acknowledgments
The majority of the data presented in this review came from projects funded
by the National Health and Medical Research Council of Australia and the
Welcome Trust. I particularly acknowledge my research colleagues Alex
Gentle, Andrew Jobling, and John Phillips who have made substantive con-
tributions to data collected on scleral changes in myopia in our laboratory.
298 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 298
299 Changes to the Sclera in Myopia
References
1. Zadnik K. (1997) The Glenn A. Fry Award Lecture (1995). Myopia develop-
ment in childhood. Optom Vis Sci 74: 603–608.
2. McBrien NA, Adams DW. (1997) A longitudinal investigation of adult-onset
and adult-progression of myopia in an occupational group — Refractive and
biometric findings. Invest Ophthalmol Vis Sci 38: 321–333.
3. Sperduto RD, Seigel D, Roberts J, Rowland M. (1983) Prevalence of myopia in
the United States. Arch Ophthalmol 101: 405–407.
4. Fledelius HC. (1988) Myopia prevalence in Scandinavia. A survey, with
emphasis on factors of relevance for epidemiological refraction studies in
general. Acta Ophthalmol Scand Suppl 185: 44–50.
5. Attebo K, Ivers RQ, Mitchell P. (1999) Refractive errors in an older popula-
tion: the Blue Mountains Eye Study. Ophthalmology 106: 1066–1072.
6. Goh WSH, Lam CSY. (1994) Changes in refractive trends and optical compo-
nents of Hong Kong Chinese aged 19–39 years. Ophthalmic Physiol Opt 14:
378–388.
7. Lin LL-K, Shih Y-F, Tsai C-B, et al. (1999) Epidemiologic study of ocular
refraction among schoolchildren in Taiwan in 1995. Optom Vis Sci 76:
275–281.
8. Celorio JM, Pruett RC. (1991) Prevalence of lattice degeneration and its rela-
tion to axial length in severe myopia. Am J Ophthalmol 111: 20–23.
9. Yannuzzi LA, Sorenson JA, Sobel RS, et al. (1993) Risk-factors for idiopathic
rhegmatogenous retinal-detachment. Am J Epidemiol 137: 749–757.
10. Grossniklaus HE, Green WR. (1992) Pathologic findings in pathologic
myopia. Retina 12: 127–133.
11. McBrien NA, Gentle A. (2003) Role of the sclera in the development and
pathological complications of myopia. Prog Retin Eye Res 22: 307–308.
12. Grey RHB, Burnscox CJ, Hughes A. (1989) Blind and partial sight registration
in Avon. Br J Ophthalmol 73: 88–94.
13. David T, Smye S, James T, Dabbs T. (1997) Time-dependent stress and dis-
placement of the eye wall tissue of the human eye. Med Eng Phys 19: 131–139.
14. David T, Smye S, Dabbs T, James T. (1998) A model for the fluid motion of
vitreous humour of the human eye during saccadic movement. Phys Med Biol
43: 1385–1399.
15. Avetisov ES, Savitskaya NF, Vinetskaya MI, Iomdina EN. (1984) A study of
biochemical and biomechanical qualities of normal and myopic eye sclera
in humans of different age groups. Metab Pediatr Syst Ophthalmol 7:
183–188.
16. Rada JA, Achen VR, Penugonda S, et al. (2000) Proteoglycan composition in
the human sclera during growth and aging. Invest Ophthalmol Vis Sci 41:
1639–48.
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 299
17. Wiesel TN, Raviola E. (1977) Myopia and eye enlargement after neonatal lid
fusion in monkeys. Nature 266: 66–68.
18. McBrien NA, Norton TT. (1994) Prevention of collagen cross-linking
increases form-deprivation myopia in tree shrew. Exp Eye Res 59: 475–486.
19. McBrien NA, Cornell LM, Gentle A. (2001) Structural and ultrastructural
changes to the sclera in a mammalian model of high myopia. Invest
Ophthalmol Vis Sci 42: 2179–2187.
20. Sellheyer K, Spitznas M. (1988) Development of the human sclera. A mor-
phological study. Graefes Arch Clin Exp Ophthalmol 226: 89–100.
21. Norton TT, Miller EJ. (1995) Collagen and protein levels in sclera during
normal development, induced myopia, and recovery in tree shrews. Invest
Ophthalmol Vis Sci 36 (Suppl): S760.
22. Marshall GE. (1995) Human scleral elastic system: an immunoelectron
microscopic study. Br J Ophthalmol 79: 57–64.
23. Birk DE. (2001) Type V collagen: heterotypic type I/V collagen interactions in
the regulation of fibril assembly. Micron 32: 223–237.
24. Kuc IM, Scott PG. (1997) Increased diameters of collagen fibrils precipitated
in vitro in the presence of decorin from various connective tissues. Connect
Tissue Res 36: 287–296.
25. Bedrossian RH. (1971) The effect of atropine on myopia. Ann Ophthalmol. 3:
891–897.
26. Guggenheim JA, McBrien NA. (1996) Form-deprivation myopia induces acti-
vation of scleral matrix metalloproteinase-2 in tree shrew. Invest Ophthalmol
Vis Sci 37: 1380–1395.
27. Siegwart JT, Norton TT. (2001) Steady state mRNA levels in tree shrew sclera
with form-deprivation myopia and during recovery. Invest Ophthalmol Vis Sci
42: 1153–1159.
28. Gaton DD, Sagara T, Lindsey JD, Weinreb RN. (1999) Matrix metallopro-
teinase-1 localization in the normal human uveoscleral outflow pathway.
Invest Ophthalmol Vis Sci 40: 363–369.
29. McBrien NA, Gentle A. (2001) The role of visual information in the control
of scleral matrix biology in myopia. Curr Eye Res 23: 313–319.
30. Bron AJ, Tripathi RC, Tripathi B. (1997) The cornea and sclera. In: Wolffs
Anatomy of the Eye and Orbit, pp. 233–278. Chapman and Hall Medical,
London.
31. McBrien NA, Metlapally R, Jobling AI, Gentle A. (2006) Expression of
collagen-binding integrin receptors in the mammalian sclera and their
regulation during the development of myopia. Invest Ophthalmol Vis Sci 47:
4674–82.
32. Gentle A, McBrien NA. (2002) Retinoscleral control of scleral remodelling
during refractive development: A role for endogenous FGF-2? Cytokine 18:
344–348.
300 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 300
33. McBrien NA, Jobling AI, Truong HT, et al. (2009) Expression of muscarinic
receptor subtypes in tree shrew ocular tissues and their regulation during the
development of myopia. Molecular Vis 15: 464–475.
34. Poukens V, Glasgow BJ, Demer JL. (1998) Nonvascular contractile cells in
sclera and choroid of humans and monkeys. Invest Ophthalmol Vis Sci 39:
1765–1774.
35. Phillips JR, McBrien NA. (2004) Pressure-induced changes in axial eye length
of chick and tree shrew: significance of myofibroblasts in the sclera. Invest
Ophthalmol Vis Sci 45: 758–63.
36. Jobling AI, Gentle A, Metlapally R, et al. (2009) Regulation of Scleral Cell
Contraction by Transforming Growth Factor-{beta} and Stress: competing
Roles in Myopic Eye Growth. J Biol Chem 284: 2072–2079.
37. McBrien NA, Jobling AI, Gentle A. (2009) Biomechanics of the sclera in
myopia: extracellular and cellular factors. Opt Vis Sci 86: 23–30.
38. Phillips JR, McBrien NA. (1995) Form deprivation myopia — Elastic proper-
ties of sclera. Ophthalmic Physiol Opt 15: 357–362.
39. Puxkandl R, Zizak I, Paris O, et al. (2002) Viscoelastic properties of collagen:
synchrotron radiation investigations and structural model. Phil Trans Royal
Soc B: Biol Sci 357: 191–197.
40. Curtin BJ. (1977) The posterior staphyloma of pathologic myopia. Trans Am
Ophthalmol Soc 75: 67–86.
41. Bell GR. (1978) A review of the sclera and its role in myopia. J Am Optom
Assoc 49: 1399–1403.
42. Curtin BJ, Iwamoto T, Renaldo DP. (1979) Normal and staphylomatous sclera
of high myopia. Arch Ophthalmol 97: 912–915.
43. McBrien NA, Lawlor P, Gentle A. (2000) Scleral remodelling in the develop-
ment of and recovery from axial myopia in the tree shrew. Invest Ophthalmol
Vis Sci 41: 3713–3719.
44. Curtin BJ, Karlin DB. (1970) Axial length measurements and fundus changes
of the myopic eye. I. The posterior fundus. Trans Am Ophthalmol Soc 68:
312–334.
45. Norton TT, Rada JA. (1995) Reduced extracellular-matrix in mammalian
sclera with induced myopia. Vision Res 35: 1271–1281.
46. Siegwart JT, Norton TT. (2002) The time course of changes in mRNA levels in
tree shrew sclera during induced myopia and recovery. Invest Ophthalmol Vis
Sci 43: 2067–2075.
47. Gentle A, Liu Y, Martin JE, et al. (2003) Collagen gene expression and the
altered accumulation of scleral collagen during the development of high
myopia. J Biol Chem 278: 16587–16594.
48. Birk DE, Fitch JM, Babiarz JP, et al. (1990) Collagen fibrillogenesis in vitro:
interaction of types I and V collagen regulates fibril diameter. J Cell Sci 95:
649–657.
301 Changes to the Sclera in Myopia
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 301
49. McBrien NA, Gentle A, Cottriall C. (1999) Optical correction of induced axial
myopia in the tree shrew: implications for emmetropization. Optom Vis Sci
76: 419–427.
50. Rada JA, Nickla DL, Troilo D. (2000) Decreased proteoglycan synthesis asso-
ciated with form deprivation myopia in mature primate eyes. Invest
Ophthalmol Vis Sci 41: 2050–2058.
51. Buschmann MD, Grodzinsky AJ. (1995) A molecular model of proteoglycan-
associated electrostatic forces in cartilage mechanics. J Biomech Eng 117:
179–192.
52. Aimes RT, Quigley JP. (1995) Matrix metalloproteinase-2 is an interstitial col-
lagenase — Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils
and soluble native type-I collagen generating the specific 3/4-length and 1/4-
length fragments. J Biol Chem 270: 5872–5876.
53. Woessner JFJ. (1991) Matrix metalloproteinases and their inhibitors in con-
nective tissue remodelling. FASEB J 5: 2145–2154.
54. Gentle A, McBrien NA. (1999) Modulation of scleral DNA synthesis in devel-
opment of and recovery from induced axial myopia in the tree shrew. Exp Eye
Res 68; 155–163.
55. Siegwart JT, Norton TT. (1999) Regulation of the mechanical properties of
tree shrew sclera by the visual environment. Vision Res 39: 387–407.
56. Phillips JR, Khalaj M, McBrien NA. (2000) Induced myopia associated with
increased scleral creep in chick and tree shrew eyes. Invest Ophthalmol Vis Sci
41: 2028–2034.
57. Jobling AI, Nguyen M, Gentle A, McBrien NA. (2004) Isoform-specific
changes in scleral TGF-β expression and the regulation of scleral collagen syn-
thesis during myopia progression. J Biol Chem 279: 18121–18126.
58. Serini G, Gabbiani G. (1999) Mechanisms of myofibroblast activity and phe-
notypic modulation. Exp Cell Res 250: 273–283.
59. Tomasek JJ, Gabbiani G, Hinz B, et al. (2002) Myofibroblasts and mechano-
regulation of connective tissue remodelling. Nat Rev Mol Cell Biol 3: 349–363.
60. Hinz B, Dugina V, Ballestrem C, et al. (2003) Alpha-smooth muscle actin is
crucial for focal adhesion maturation in myofibroblasts. Mol Biol Cell 14:
2508–2519.
61. Wallman J, Wildsoet C, Xu AM, et al. (1995) Moving the retina — Choroidal
modulation of refractive state. Vision Res 35: 37–50.
62. Troilo D, Nickla DL, Wildsoet CF. (2000) Choroidal thickness changes during
altered eye growth and refractive state in a primate. Invest Ophthalmol Vis Sci
41: 1249–1258.
63. Wildsoet CF, Schmid KL. (2000) Optical correction of form deprivation
myopia inhibits refractive recovery in chick eyes with intact or sectioned optic
nerves. Vision Res 40: 3273–3282.
302 N.A. McBrien
b846_Chapter-4.2.qxd 4/8/2010 2:02 AM Page 302
The Mouse Model of Myopia
Frank Schaeffel*
Introduction
The mouse has recently expanded the spectrum of animal models for
studies on myopia,
1,2
after chicks,
3
tree shrews,
4
rhesus monkeys,
5
and
guinea pigs
6
had already been used for a number of years. A driving force
for introducing the mouse model was that it offers a number of advantages
over the other models. These advantages include the availability of numer-
ous knock-out mutants; most advanced gene microarrays for screening
the transcriptome, a completely sequenced genome; the fact that the
mouse is the most extensively studied mammalian model for human dis-
eases; the fact that considerable knowledge exists already about biochemi-
cal pathways and pharmacology; and finally, that mouse strains can be
easily crossed and bred. These advantages are counter-balanced by a num-
ber of disadvantages. In particular, compared to chicks and monkeys, mice
are not predominantly “visual animals,” and their spatial resolution
(around 0.5 cycles/degree) is about 100 times less than in humans, about
80 times less than in the monkey, and 15 times less than in chickens, and
still about five times less than in the guinea pig. Furthermore, fast eye
growth would be advantageous if the effect of visual input on eye growth
is to be studied, and again, the mouse does not seem optimal: its eye grows
only 0.15% per day over the first 100 days, which is about 10 times slower
than in the chicken (1.1%). Accordingly, significant effects of the depriva-
tion of sharp vision can be observed on eye growth in the chick model
303
4.3
*Section of Neurobiology of the Eye, Ophthalmic Research Institute, Calwerstrasse 7/1, 72076 Tübingen,
Germany. E-mail: [email protected]
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 303
already after one to two days, but two to three weeks are necessary in the
mouse. Furthermore, treatment of mice with diffusers or lenses is
demanding, compared to chicks, and experiments often fail because the
mice had removed their eye occluders or lenses. Finally, the small size of
the eye of the mouse (little more than 3 mm in diameter in adult mice
7
;
and Fig. 1) requires new technology to measure ocular dimensions and
optical properties with sufficient precision.
Despite these obstacles, the number of publications on myopia in the
mouse model increases continuously, and the results were surprisingly
clear in some cases.
This chapter will review: (1) the spatial visual performance of the
mouse and the optical features of its eye; (2) the techniques that are now
available for myopia studies in the mouse, both for induction and its
measurement; and (3) examples of results that were recently obtained
using the mouse model. This review extends and updates a previous analy-
sis of the mouse as a model of myopia,
8
but will still not cover all studies
that were published on this topic.
Spatial Visual Performance and Optical Features of the Eye
The mouse eye, scaled to body weight, is five times larger than the human
eye and therefore cannot be considered vestigial. A basic question is
whether it also provides “scaled visual acuity.” In a human eye, one degree
of the visual field maps on 0.29 mm linear distance on the retina. In a
28-day-old mouse, the image magnification is only a tenth (0.03 mm/deg).
Accordingly, even with the best possible optics, a mouse eye can achieve
only a tenth in angular resolution — about 5 cyc/deg — since the “pixels”
of the image, the photoreceptors, cannot be made much smaller.
Behavioral (see detailed descriptions below) and electrophysiological
studies
9
show, however, that the spatial resolution of the mouse eye is con-
siderably lower by another factor of 10 — only about 0.5 cyc/deg.
Although the optics of the mouse eye are far from diffraction-limited,
10
it does not seem to be the final limiting factor in visual acuity. Also, cone
photoreceptor diameters do not vary much between human and mouse
(mouse >2–3 µm; humans 2–8 µm),
11,12
and it remains to be explained
why the mouse has such poor spatial resolution. Unexpectedly, there is
also no clear evidence for a higher level of convergence of photoreceptor
304 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 304
signals in the mouse retina. The ratio of optic nerve fibers in human and
mouse (about 1,100,000 in human versus 66,000 in mouse)
13
is about 16:1,
and matches roughly the ratio of the retinal areas (14:1) — definitely
different, for instance, from the cat (fiber number for human to cat is
about 13:1 vs retinal area ratio 1.4:1), suggesting that a much higher level
of photoreceptor convergence exists in the cat retina, compared to mouse
or human. These findings suggest that mouse spatial vision is not opti-
mized for low illuminances, unlike in the cat. In fact, Schmucker et al.
14
found that the spatial resolution of mice in an optomotor task increased
with increasing illuminances (up to 400 lux), but was very poor at 4 lux.
Given poor visual acuity, depth of focus should be large and it is possible
that emmetropization (the developmental matching of axial eye length to
the focal length of the eye optics) may not be as precise as in some birds
or primates. To focus an image of the environment onto the retina of a
mouse eye, a refractive power of cornea and lens of more than 500 diopters
[D] is necessary in air (a third of the power is lost because the vitreous cav-
ity is, like in all vertebrate eyes, filled with water-like fluid). Relative to the
500 diopters of optical power, refractive errors of a few diopters may be
negligible, and imperfections in the optics of the mouse eye may have less
impact on vision than in humans. However, regarding emmetropization,
one should keep in mind that a change in axial length of only about 5 µm
in the mouse changes the refractive state already by about one diopter.
15
Even if the depth of focus of the mouse eye is as large as 10 diopters (see
below), the absolute axial growth, determined by the growth of the scleral
tissue, needs to be regulated with a precision of 50 µm in axial direction,
which is similar to that in the chicken, where this value converts to about
one diopter.
16
Remtulla and Hallett
7
were the first to present a schematic eye model
for the adult C57B1/6J mouse, based on frozen sections of 14 eyes of
20–23-week-old animals. Later, Schmucker and Schaeffel
15
developed a
paraxial schematic eye model for C57BL/6J mice at different ages, also
based on frozen sections. Although frozen sections have limited resolution
due to distortions that may occur during freezing and sectioning, it is
always possible to take averages from several eyes, and to fit the biometri-
cal data from different ages by polynomials. The averaging procedure
reduces the impact of measurement variability, and a few general state-
ments could be made about the optics of the mouse eye, which are now
compared to more recent measurements with other techniques.
305 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 305
Axial eye growth and development of refractive state
In line with an observation by Zhou and Williams,
17
Schmucker and
Schaeffel
15
observed that the eyes grew about linearly in C57BL/6 mice
over the first 100 days with no signs of saturation. Axial length grew from
3.0 mm at P22 by 4.4 µm per day. Zhou et al.
18
used a custom-built low
coherence interferometer with focal plane advancement (described in
detail in Zhou et al.)
19
to measure axial eye growth in another strain of
C57BL/6 mice. They found that axial eye growth was most rapid between
P22 and P35 (about 17 µm per day) and slowed down to about 3 µm per
day between P53 and P100. The average growth rate over the whole period
was similar, however (5.9 µm/day).
Another developmental study in C57BL/6 mice was recently conducted
using high resolution small animal MRI20. These authors also found
nonlinear growth functions, with a fast growth phase followed by a
slower phase. Axial length increased rapidly from P22 to P40, from 2.95
mm to 3.17 mm, followed by a slower increase to about 3.3 mm until P90.
Barathi et al.,
21
who studied axial eye growth Balb/cJ albino mice in
excised eyes with digital calipers, also observed the most rapid axial eye
growth between P1 and P56 (about 21 µm per day), and a slower growth
rate of only 1.8 µm thereafter (average: 9.6 µm/day). No saturation of
axial eye growth was obvious even beyond 100 days of age in any of these
studies.
It is interesting that the growth rates were variable in the two studies
using C57BL/6 mice, in particular between P22 and P35, but frozen sec-
tions and low coherence interferometry may give slightly different results
in small and soft eyes. Axial eye growth, as measured in these studies, is
shown in Fig. 1A, and development of refractive states in Fig. 1B. While
axial eye growth was similar in all studies, there were large differences in
refractive development, even though the refractions were determined with
copies of the original infrared photorefractor,
22
at least in the four studies
on black mice. It is a question to be answered in the future, why different
C57BL/6 strains show different refractive development, and whether this
is genetically determined or due to environmental differences in the ani-
mal facilities. Large difference in refractive development were recently also
found in guinea pigs: a Chinese tricolor guinea pig strain had a significant
proportion of spontaneously myopic animals
23
— a condition that was not
found in other guinea pig studies (e.g. Ref. 24).
306 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 306
Lens thickness and vitreous chamber depth
Because the lens grew in thickness from 1.74 mm at P22 by 5.5 µm per day,
vitreous chamber depth declined from 0.83 mm at 22 days, by 3.2 µm per
day
15
(illustrated in Fig. 2). In the study by Zhou et al.,
18
lens thickness was
1.47 mm at P22 and increased daily by about 7.9 µm until P53, and grew
slower (about 1.8 µm/day) thereafter. Again, vitreous chamber depth
declined with age by 1.4 µm per day between P22 to P102.
Corneal radius of curvature
A recent study, using video photokeratometry in Egr1 –/– mice and their
wild type littermates
27
showed that corneal radius of curvature grows from
1.35 mm to 1.53 mm from day 22 to 100 — an average daily growth rate
of 2.3 µm. Zhou et al.
18
observed a rapid increase in corneal radius of cur-
vature by 9 µm per day between P22 and P35, and a slower phase with a
daily increase of 0.8 µm thereafter (average growth rate over the whole
period: 2.8 µm/day, similar to Ref. 27).
307 The Mouse Model of Myopia
Figure 1. (A) Axial eye growth in mice with normal visual experience as measured in four stud-
ies, using either C57BL/6 mice (Zhou et al.
18
— using a custom-built low coherence inter-
ferometer; Schmucker and Schaeffel
15
— using frozen sections, Tkatchenko et al.
20
— using
high resolution small animal MRI) or Balb/cJ albino mice (Barathi et al.
21
— using digital
calipers in freshly excised eyes). (B) Development of refractive states in these four studies
(same symbols denote same study) with data added from the study by Pardue et al.
25
Infrared photorefraction was used in the studies on black mice and streak retinoscopy in
the albino mice (Barathi et al.).
21
Note that axial eye growth was similar in all studies, but
that there were considerable differences in refractive development.
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 307
Schematic eye data
To make a mouse eye more myopic by one diopter, axial length has to
increase by 5.4 µm at the age of 22 days and by 6.5 µm at the age of
100 days. Retinal image magnification increased from 0.032 mm/deg at
22 days to 0.034 mm/deg at 100 days in the study by Schmucker and
Schaeffel
15
— not too much of a difference. Using the data by Zhou
et al.,
18
an axial length of 2.86 mm at P22 converts into an image magni-
fication of about 0.030 mm/deg, and an axial length of 3.34 mm at P102
into 0.034 mm/deg, similar to Schmucker and Schaeffel.
15
As in other animals (e.g. chicken, barn owl),
28,29
the retinal image
brightness increases with age. Image brightness is proportional to the
inverse squared f/number, the ratio of anterior focal length to pupil size.
Typical for humans are f/numbers around 5 (for a 3.3 mm pupil), but for
the mouse, the f/number is as low as 1.02 at day 22. This produces a reti-
nal image 25 times brighter than in humans. Until the age of 100 days,
the f/number declines even further, to about 0.93, providing another 20%
308 F. Schaeffel
Figure 2. Frozen sections of mouse eyes at the ages of 26 and 44 days (re-plotted from Ref. 15).
Note that the lens is growing faster than the globe, reducing vitreous chamber depth with
age. Note also that accommodation is very unlikely since the large lens can neither be moved
nor deformed. Note also the relative thickness of the retina, which should give rise to a large
“small eye artifact” in retinoscopic measurements.
26
Scale bars denote millimeters.
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 308
more brightness. Even owls do not have such a low f/number (1.13
29
), and
it is clear that the mouse has probably one of the brightest retinal images
among vertebrates. The thickness of the retina, relative to axial length
(which grows from 0.178 mm at 22 days of age by 0.6 µm per day), should
give rise to a large difference in the position of the photoreceptor layer and
of the light reflecting layer(s) in retinoscopy — resulting in large amounts
of apparently measured hyperopia (the “small eye artifact”).
26
From the
schematic eye, the small eye artifact was calculated to more than 30 D.
15
Since neither infrared photorefraction nor streak retinoscopy showed such
large amounts of hyperopia, mice must either be myopic (which is not in
agreement with behavioral data, see below), or the light reflecting layer(s)
is (are) not at the vitreo-retinal interface, but rather deeper in the retina.
Techniques Currently Available for Myopia Studies in
the Mouse, Both for Its Induction and Measurement
The large depth of field and relatively low visual acuity of the mouse sug-
gest that the retinal image degradation must become quite severe before it
is detectable for the retina, and before it can potentially trigger changes in
eye growth.
Devices to induce refractive errors
The first attempts were made by gluing hemispherical frosted plastic goggles
over the eye of C57BL/6 mice, using instant glue (Fig. 3, from Schaeffel
et al.).
22
The problem was that the mice tended to remove these goggles. A
plastic collar was necessary to prevent the mice from reaching the goggles.
Even then, it was demanding to keep the eye covers in place for two weeks.
22
Barathi et al.
21
managed to keep velcro rings, glued to the fur in Balb/cJ
albino mice, in place from P10 to P56. These rings even carried hard contact
lenses. Also, Tkatchenko and Tkatchenko
30
managed to keep them in place
without a collar. Because of the problems associated with gluing the devices
to the fur around the eye, Faulkner et al.
31
developed a head-mounted
pedestal in which a holder was implanted in the skull and the diffusers were
carried by a wire. These devices were well tolerated by the mice, but they
were applied rather late at P28. They were kept in place until P84.
25
Continuous light rearing, which causes severe flattening of the cornea
and large hyperopic refractive errors in chickens
32
was also attempted but
309 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 309
no effect on corneal curvature in C57BL/6 mice was found. After 37 days
in continuous white light with about 500 lux ambient illuminance,
corneal radius was 1.42 ± 0.04 mm (n = 25 eyes), versus 1.40 ± 0.05 mm
(n = 20 eyes) in animals kept under regular 12/12 h light/dark cycle.
There were significant differences in refraction (+3.1 ± 3.6, n = 40, versus
+6.4 ± 4.3, n = 51, p < 0.001), but these small changes were in the opposite
direction as in chickens.
8
Finally, lid suture was also used to induce deprivation myopia
2,33
in
20 days or four weeks, respectively. Non-visual effects on eye growth can-
not be excluded, such as increased mechanical pressure on the globe,
which might cause a rebound effect after lid re-opening, changes in the
metabolic conditions due to reduced oxygen supply or elevated ocular
temperature.
Techniques to measure the induced refractive
errors and changes in eye growth
Refractive state
In a number of studies, refractive states were measured by white light
streak retinoscopy (e.g. Refs. 2, 7, 33, 34). In streak retinoscopy, a slightly
310 F. Schaeffel
Figure 3. C57BL/6 mouse with a hemispherical plastic diffuser attached in front of the right
eye. The plastic collar was attached to prevent the mouse from removing the diffuser (from
Ref. 22).
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 310
defocused light streak is projected onto the eye from the retinoscope,
which is held at about an arm’s length from the mouse. A small fraction of
this light is reflected from the back of the eye, the fundus, and is visible in
the pupil. The movement of the reflection in the pupil must be compared
to the movement of the light streak seen on the fur surrounding the eye,
while the streak retinoscope is tilted up and down.
If the reflection in the pupil appears stationary with no clear direction
of movement, the “reversal point” is reached and the eye can be assumed
to be in focus with the observer. Otherwise, differently powered trial lenses
are held in front of the eye until the reversal point is reached, and the lens
power provides the information about refractive state. The procedure
works well in animals with large pupils, but it is very difficult to judge the
direction of movement of the light bar in small pupils (1 mm in diameter,
or even smaller, if the pupil constricts due to the white light emitted by the
retinoscope). In a trial carried out by a certified optometrist, no correla-
tion was found between streak retinoscopy and infrared photoretinoscopy
in
22
alert, non-cyclopleged black mice.
8
Streak retinoscopy also provided
generally more hyperopic readings than infrared photoretinoscopy (see
below). High hyperopia was also found in other studies using streak
retinoscopy (+20 D
34
; +13.5 D
2
; +15 D
33
; and >+10 D
21
— see Fig. 1B).
An interesting case involves albino mice (as used by Barathi et al.).
21
In
these mice, the iris is scarcely pigmented and light penetrates easily.
Therefore, these animals are, in fact, mainly refracted through the iris,
mimicking a large pupil — finally limited only by the diameter of the
cornea. The movement of the retinoscopic reflection can therefore be
judged much more easily than in (non-cyclopleged) black mice. Given
that light scatter in the iris should further degrade the retinal image, it is
interesting that myopia could still be induced by negative lenses in front
of the eye.
A perhaps powerful technique for refracting small vertebrates is
infrared photoretinoscopy. This technique is video-based, uses infrared
light, and has been successfully applied in a variety of vertebrate eyes
(e.g. barn owls; toads and tadpoles; frogs and salamanders; water
snakes).
29,35–37
Since infrared light is used, the animal is not disturbed by
the measurement and the pupil does not constrict. To measure a mouse, it
is sufficient to slightly restrain it by holding its tail while it rests on a small
platform and turning down the room light since the pupil of the mouse is
very responsive to light.
38
An infrared sensitive video camera is positioned
at about 60 cm distance. Attached to the camera lens is an arrangement of
311 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 311
infrared light emitting diodes (IR LED; see Fig. 4A). A small fraction of
this light enters the pupil, is diffusely reflected from the fundus of the eye,
and returns to the camera. Because the IR LEDs are positioned directly
below the camera aperture, they produce a brightly illuminated pupil —
like the “red eye effect” seen with flash cameras. Furthermore, the bright-
ness distribution in the vertical pupil meridian displays a gradient, with
more light in the bottom in the case of a myopic eye (a screen dump of the
refraction software is shown in Fig. 4B), and more light in the top of the
pupil in a hyperopic eye. The brightness distributions in the pupils of mice
are not smooth, but bumpy, indicating that the optics has considerable
aberrations; furthermore, they are affected by the first Purkinje image.
Figure 4B shows the measured brightness profile, together with a linear
regression line fit through the pixel brightness values. Refractions can be
determined from the slopes of these regression lines. The only unknown
variable is then the conversion factor from the slope of the brightness pro-
file in the pupil into refraction. However, this factor can be determined by
placing trial lenses of known optical power in front of the mouse eye,
inducing known refractive errors, and recording the slopes.
22
312 F. Schaeffel
Figure 4. (A) USB2 monochrome video camera, 50 mm lens with focal length extender and
10 mm extension ring, and custom-built photoretinoscope. The camera and the infrared
LEDs of the photoretinoscope can be run through the USB port of the laptop, making addi-
tional power supplies unnecessary. (B) Screen dump of the software, developed in Visual
C++, designed to measure refraction and pupil size with 62 Hz sampling rate. In addition,
light-induced pupil responses can be recorded, which are elicited by a green LED attached
to retinoscope (not shown in the version in (A)) and flashed through the USB port.
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 312
The temporal sampling rate of this technique is currently 62 Hz, a
typical frame rate for USB2 cameras (Fig. 4A). As soon as the mouse
eye appears in the video frame, the image processing software detects the
pupil — which is a simple task because it is brightly illuminated over a
dark background — and fits a linear regression through the pixel bright-
ness values in the vertical pupil meridian.
Even though the measurements are easy to perform, some limitations
have to be considered:
1
because of the excavation of the optic disc (nicely
visible in the frozen section of the mouse eye presented by Remtulla and
Hallett
7
), the eye is more myopic (or less hyperopic), close to the pupil-
lary axis and appears considerably more hyperopic in the periphery due
to the thickness of the retina.
22
Therefore, for consistent refractions, it is
important to align the eye with the camera axis.
22
It was observed that
mice sometimes change their refractive state for a few seconds and
become a few diopters more myopic. The mechanism behind this optical
change has not yet been systematically studied but it is clear that it occurs
without visual stimulation and does not represent accommodation. It was
also observed under cycloplegia with Tropicamide,
22
and Woolf
39
was
unable to find a ciliary muscle for accommodation in the mouse eye.
Also, Smith et al.
40
stated that the ciliary muscle in the mouse eye is weak
and lacks accommodation. An alternative explanation for this change in
refraction is that it is produced by activity of the retractor bulbi mus-
cles,
41,42
which can pull the globe back into the orbit, causing a temporary
change in intraocular pressure, which, in turn, could affect the refractive
state. Therefore, it is important to observe mice for several seconds to
ensure that their eyes are in a relaxed condition.
22
It was found that mice
were measured more hyperopic when they had larger pupils (about 0.9 D
more hyperopia per 0.1 mm increase in pupil size).
22
This effect could
result from negative spherical aberration (more hypopic refractions in
the pupil periphery). On the other hand, positive spherical aberration
was found in mouse eyes by Hartmann-Shack aberrometry,
10
and it is
more likely that the increasing hyperopia results from non-linearities in
the video system. Larger pupils return more light, proportional to the
pupil area, and pixel values are not perfectly log-linear to the absolute
brightness. A more extensive calibration with different camera aper-
ture sizes would be necessary to control this factor. The standard devia-
tion typically obtained in the same eyes in repeated measurements was
about 2.7 D
22
— much less than the optical and behavioral depth of
focus (see below).
313 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 313
Corneal radius of curvature
The corneal surface is optically the most powerful surface of the eye; in
most vertebrates, it generates more than 60% of the total optical power.
Therefore, it is important to measure its radius of curvature. This can be
done by infrared photokeratometry in alert mice.
15
Mice are placed on a
platform (Fig. 5A) and slightly restrained by holding their tails. The plat-
form is positioned at about 15 cm from a metal ring with a diameter of
300 mm that carries eight IR LEDs. The reflections of the IR LEDs on the
corneal surface, the first Purkinje images, are also arranged in a circular
pattern (Fig. 5B). In a digital video image of the eye, the reflections can be
detected by an image processing program and fit by a circle in real time.
The diameter of the fitted circle is proportional to the curvature of the
cornea — small circles for steep corneas with small radius of curvature,
and larger circles for flat corneas.
Although the equations to calculate corneal curvature from camera
distance, distance of the IR LEDs of the keratometer, distance of the
keratometer to the mouse, and camera magnification have been worked
out,
44
it is easier to measure a ball bearing with known radius of curvature,
compare it to the measured radius of curvature, and find the correction
factor. Since the system is almost perfectly linear, one factor is sufficient to
derive the true corneal radius of curvature of the animal. The standard
314 F. Schaeffel
Figure 5. Measurement of corneal radius of curvature in alert mice, using IR photokeratometry.
(A) The mouse (white arrow) is restrained only by holding its tail, but because its eye
needs to be positioned in the small field of view of the video camera with a 135 mm lens
at a well defined position (depth of field only about 1 mm), the platform is moved back
and forth until the first Purkinje images of eight IR LEDs, arranged in a circle, are in good
focus. The software continuously fits circles through the eight Purkinje images and
provides their radius.
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 314
deviation of this procedure is about 1%, with the major source of vari-
ability the depth of focus of the video camera.
Axial length measurements and ocular biometry
Perhaps the most important variable in myopia studies is axial length. The
type of myopia that is experimentally induced in animal models is almost
always axial. Therefore, the first question is about the axial length changes.
There were several attempts to measure axial eye lengths in mice: video
imaging of freshly enucleated eyes
21,22,45
; analysis of histological sections of
eyes
2
; highly enlarged photographs of frozen sections
15
; and eye weight
measurements.
17
These techniques could be used only post-mortem, and
all may have limited resolution to detect experimentally induced axial
myopia. Attempts to measure axial eye length in vivo with A-scan ultra-
sonography (which is typically used in other animal models of myopia)
also failed in the small eye of the mouse.
22
Major progress was therefore
made when a commercial optical low coherence interferometer (OLCI)
was adapted to measure short-range optical distances. The initial goal was
to measure corneal thickness and anterior chamber depth in humans (the
Carl Zeiss “AC Master” (http://www.meditec.zeiss.com/), Jena, Germany).
A test showed that this device was also able to measure the intraocular dis-
tances in living mouse eyes.
46
Unfortunately, the company decided not to
market the AC Master so that only prototypes are currently available to a
315 The Mouse Model of Myopia
Figure 6. Measurements of ocular dimensions in a mouse with the “AC Master” (Zeiss-Meditec,
Jena, Germany). (A) The slightly anesthetized mouse, positioned on an adjustable platform,
which is attached to the chinrest of the device, is encircled. (B) Close-up view used to adjust
the eye in the measurement beam. The first Purkinje images of six infrared LEDs, built into
the device, are used to align the eye.
46
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 315
few laboratories.
21,46,47
Therefore, custom-built low coherence interferom-
eters were introduced,
19
or are currently under construction.
The optical principle of optical low coherence interferometry is based
on a Michelson interferometer. A low coherence superluminescent laser
diode (SLD) that emits an infrared light with a peak emission at 850 nm
and a half-band width of 10 nm serves as light source. Due to the broad-
ened bandwidth, the coherence length is rather short (about 10 µm), com-
pared to standard laser diodes, in which it is about 160 µm. The infrared
laser beam emerging from the LED is divided into two perpendicular
beams via a semi-silvered mirror. One part is transmitted through the
semi-silvered mirror and reaches a stationary mirror. The other part
reaches a second mirror that can be moved along the light path with high
positional precision. After reflection from both mirrors, the two coaxial
beams propagate to the eye, where they are reflected off from the cornea,
the lens, and the fundal layers. Interference between both beams can only
occur when their optical path lengths are matched with extreme precision,
within the coherence length. The occurrence of interference is detected by
a photo cell and recorded as a function of the displacement of the movable
mirror. Due to the usage of coaxial beams, the measurements are largely
insensitive against longitudinal eye movements. The scanning time of the
movable mirror is about 0.3 sec. In the human eye, a measurement preci-
sion in the range of 2 µm has been achieved in corneal thickness measure-
ments, and of 5 to 10 µm for the anterior chamber depth and lens thickness
measurements (R. Bergner, Carl Zeiss Meditec, Jena, personal communi-
cation, 2004). In repeated measurements in mouse eyes, a standard devia-
tion of 8 µm was found for axial length — equivalent to less than two
diopters.
46
It should be kept in mind that optical path lengths are measured with
this technique, which need to be converted into geometrical path lengths.
This requires that the refractive indices for the ocular media are known.
The problem has been analyzed by Schmucker and Schaeffel.
46
The errors
are generally small even if the refractive indices are not exactly known.
Also, in most cases, differences are of interest between the treated and
control eyes, rather than absolute axial lengths.
Measurements of the optical aberrations of the mouse eye
In recent years, new optical techniques have been developed to describe
the optical quality of the human eye in vivo. Perhaps the currently
316 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 316
most successful technique, the Hartmann–Shack aberrometer, has been
adapted for measurements in mice.
10
For Hartmann–Shack measurements,
a superluminescent diode at 676 nm produces a bright spot on the retina.
A fraction of the light is reflected from the fundus and returns from the
eye through the pupil. This light reaches a microlens array of 65 × 65
square lenslets with a 400 µm aperture and a focal length of 24 mm. The
lenslets create a pattern of focal spots on a CCD chip of a video camera. If
an eye has no aberrations and is focused at infinity, the spot pattern is per-
fectly regular and each of the foci is exactly along the optical axes of the
lenslets. However, if the wavefront is distorted due to optical aberrations
in the cornea and lens, the focal spots are laterally displaced and form
irregular patterns (Fig. 7, the left columns show the original Hartmann-
Shack images). The displacement of each of the foci is proportional to the
317 The Mouse Model of Myopia
Figure 7. (A) Original Hartmann–Shack images, and reconstructions of the wavefronts recorded
from 12 eyes of alert mice. Wave aberration maps are for the third and higher order
aberrations, and contour lines are plotted in 0.1 µm steps. (B) Calculations of the average
modulation transfer functions of the mouse eyes. Note that the contrast transfer drops off
steeply with increasing spatial frequency, but that the contrast transfer is still around 20%
at 4 cyc/deg (replotted after de la Cera et al., Ref. 10).
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 317
tilt of the wavefront at the respective position. To reconstruct the three-
dimensional shape of the wavefront, the centers of the focal spots are
detected by image processing software — a demanding task if they are as
diffuse, as shown in Fig. 7.
10
The shape of the wavefront is typically
described as a Polynomial expansion, as proposed by Zernike. The coeffi-
cients describe the magnitude of known optical aberrations, like defocus,
astigmatism, spherical aberration, and so on. In the measurements in the
mouse, defocus was the most dominant term (average hyperopia +10.1 ±
1.4 D), but also astigmatism (3.6 ± 3.7 D) and positive spherical aberra-
tion (wavefront error 0.15 ± 0.07 µm for a 1.5 mm pupil) were highly
significant. At least, the measurements with the Hartmann–Shack sensor
provided quite similar spherical refractive errors to the infrared photore-
fractor (Fig. 1B).
The Zernike coefficients also permit the calculation of how much con-
trast the optics of the eye transfers at the different spatial frequencies. The
transfer function is called modulation transfer function (MTF). It shows
that the mouse eye’s optics transfers are still about 20% of the contrast at
4 cyc/deg. Comparing this value to the behavioral limit of spatial resolu-
tion of the mouse — around 0.5 cyc/deg, it is unlikely that the optics of the
eye is the limiting factor for visual acuity in mice.
It turned out that alert mice could be accurately positioned for
Hartmann–Shack aberrometry by just holding their tails, moving the plat-
form, and waiting until they calmed down. It was also attempted to per-
form measurements under anesthesia. However, the optical quality of the
eyes was then much poorer.
10
This could explain why such low optical
quality was described in rodent eyes in a previous study in mice and rats.
48
Remtulla and Hallett
7
initially estimated the depth of field of the mouse
at as large as +56 D, based on photoreceptor diameters and using the equa-
tions provided by Green et al.
78
But they also stated that this must be an
unrealistic number. They noted that behavioral visual acuity may be five
times higher as calculated from anatomical variables,
49
and finally esti-
mated the depth of field as +11 D.
Aberrometric techniques permit a more direct estimation of the optical
depth of field. De la Cera et al.
10
calculated the contrast transfer (modula-
tion) of the mouse optics for a sine wave grating of 2 cyc/deg, at different
amounts of defocus. They found that modulation drops to 50% already at
about 5 D of defocus. Since the spatial acuity of the mouse is only about a
fourth of this value in behavioral studies, the depth of field should be
318 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 318
several times larger. Schmucker and Schaeffel
50
elicited optomotor
responses in mice by drifting 0.03 cyc/deg square wave gratings when mice
were wearing trial lenses. Significant responses were found with +10 D of
imposed defocus. In summary, at least for lower spatial frequencies, the
depth of field of the mouse would exceed ±10 D.
Behavioral measurement of grating acuity
and contrast sensitivity in the mouse
There were several approaches to measuring spatial visual performance in
mice behaviorally. These approaches can be divided into two principles,
testing forced choice behavior in a swimming task, the “Visual Water Task,
VWT”
51,52
or measuring the optomotor response to drifting gratings that
are either presented as printed on paper and attached to the inner wall of
a rotating drum, or more sophisticatedly, presented on computer monitors
that are arranged in a square (the “virtual optomotor system, VOS”) that
permitted better control of the stimulus variables.
53–57
The first approach
measures visual acuity for stationary targets, and the second for moving
targets. Processing of the two stimulations involves different brain areas.
While acuity for stationary targets is largely determined by geniculo-cor-
tical processing, moving targets are processed in the subcortical accessory
optic system.
55
Prusky and Douglas
58
have shown that ablation of the cor-
tex did not change the cut-off spatial frequency measured with the visual
water task (VWT) and the virtual optomotor system (VOS), but the con-
trast sensitivity functions were changed. Contrast sensitivity was increased
in the VOS but the range of high contrast sensitivity was found at lower
spatial frequencies (contrast sensitivity of about 20 at 0.05 cyc/deg with
the VOS, but only about two with the VWT). Another interesting aspect
observed in the VOS was that tracking occurred only in the temporal-to-
nasal direction for each eye, similar to the condition in infants (e.g.
Ref. 59). This means that, depending on the direction of motion of the
stripes, each eye can be independently tested.
55
Different body movements, elicited by the drifting gratings, can be
studied: head tracking,
53,60
optokinetic nystagmus of the eye,
61,62
or whole
body optomotor responses.
14,27
It could be expected from the very bright retinal images of the mouse
(see above — schematic eye data) that mice also have good spatial vision
at low ambient illuminances. However, optomotor experiments in an
319 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 319
automated optomotor drum suggest that this is not the case. Individual
mice were placed in a small perspex drum in the center of a larger drum
that was rotated with vertical square wave patterns of adjustable funda-
mental spatial frequency (Fig. 8).
Their movements were recorded from above by a little surveillance
video camera. Movement analysis was fully automated. Both the angu-
lar movement of the center of mass of the mouse and angular changes
in the orientation of the body axis were tracked by image processing
320 F. Schaeffel
Figure 8. Automated optomotor drum. The mouse is placed in a small inner perspex drum in
the center of a larger drum, which is covered inside with the square wave stripe pattern
(black arrow). The large drum is mechanically rotated by a DC motor. Both the center of
mass of the mouse and the angular orientation of its body axis are automatically tracked by
a video system (black arrow: small surveillance firewire camera that images the mouse, see
also laptop screen). The net angular movement is statistically evaluated and compared to
the stripe pattern’s direction of movement.
14
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 320
software and automatically statistically analyzed. Even though the mice
often ignored the visual stimuli when they cleaned themselves, the
objective video tracking procedure produced statistically meaningful
results. An advantage of the procedure was that the mice experienced no
further behavioral restriction, causing little stress. The disadvantages
are that the “whole body optomotor response” is less reliable than the
eye
61,62
or head
63
optomotor response, and that the data is therefore
more noisy.
The automated version of the “whole body optomotor analysis”
14
pro-
vided some new results: Grating acuity reached its limit at about 0.4 to
0.5 cyc/deg, similar to other published optomotor experiments in which
eye movements were evaluated. Grating acuity declined continuously
when the illuminance (or luminance) was reduced: The “relative
responses” were 100% at 400 lux (about 30 cd/m²), 76% at 40 lux (about
0.1 cd/m²), and 46% at 4 lux (about 0.005 cd/m²). A similar decline in
visual acuity with decreasing illuminances was also described by
Abdeljalil et al.
63
Mutant mice lacking either rods or cones, or both,
showed reduced visual acuity in cone-only models (0.10 cyc/deg in Rho
–/– and 0.20 cyc/deg in CNGB1–/– compared to 0.30 cyc/deg in
C57BL/6 wild-type mice). The “all-rod-mouse” (CNGA3 –/–) performed
similarly in the optomotor test as the wild-type, both under photopic
and scotopic conditions. This observation suggests that the rod system is
not saturated, even at illuminances of 400 lux (about 30 cd/m²). It
should also be kept in mind that rods represent about 95% of the pho-
toreceptors in most vertebrates,
64
including the mouse. Since the remain-
ing 5% of cones are not clustered in a fovea but rather more evenly
distributed across the retina, they may not reach a sampling density nec-
essary for good spatial vision. In mice without any functional photore-
ceptors (CNGA3 –/– Rho –/–), no optomotor response could be elicited,
suggesting that the light sensitive, melanopsin-containing ganglion cells
do not contribute to spatial vision.
In summary, the considerable number of behavioral studies have pro-
vided surprisingly consistent results: The highest contrast sensitivity of
BL57J/6 mice is about 20 (equivalent to a threshold contrast of 5%) or
even better (up to 10061), and is reached at high illuminances between
30 cd/m²
14
and 63 cd/m²
56
at spatial frequencies of between 0.1 and
0.2 cyc/deg. The highest detected spatial frequency (denoted as “grating
acuity”) is around 0.5 cyc/deg.
321 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 321
Recent Studies on Myopia in the Mouse Model:
Some Examples
Magnitudes of experimentally induced
refractive errors in wild-type mice
The success of experiments to induce “deprivation myopia” (the type of
myopia that develops “by default” when the retinal image clarity is exper-
imentally degraded) was surprisingly variable across studies. Schaeffel and
Burkhardt,
1
using frosted hemispherical diffusers (Fig. 3) obtained a small
myopic shift only 3–4 D after two weeks, starting at P24, which reached a
significance level of p < 0.00036 in eight mice after one outlyer was
excluded. Tejedor and de la Villa,
2
using lid suture for up to 20 days,
starting at P10-11, induced little more than 6 D of myopia and found an
impressively smooth correlation between axial length changes and refrac-
tion changes. Barathi et al.,
21
using early lid suture in a large number of
albino mice (n = 80), starting at P10 and continuing until P56, induced
up to 14 D of myopia and an axial elongation of about 200 µm. In exper-
iments by Pardue et al.,
25
it took wild-type mice eight weeks, starting at
P28, to develop a myopic shift of about 5.5 D. Tkatchenko and
Tkatchenko
30
induced about 45 µm increase in vitreous chamber depth
by treating C57BL/6J mice with frosted diffusers from P24 for a duration
of 21 days. These changes were measured with a demanding, small ani-
mal MRI. Biometric changes were accompanied by refraction shifts of
about 4 D, but the significance levels were low due to the low number of
animals (n = 4).
The large variability in the diffuser experiments cannot be explained by
poor measurement resolution (see description of the resolution of the
techniques used above); it must result from low sensitivity of the
emmetropization mechanism to changes in visual experience, and the fact
that axial eye growth is rather slow in mice (Fig. 1A). Somehow, one might
expect poor responsiveness due to the large depth of focus (more than
+10 D). But then it remains unclear why the variability of the refractions
among untreated animals is considerably less than the depth of focus
(about +3 D
22
; or even less ±1.14 D).
10
This poses the question as to what
keeps the refractions in such close range when emmetropization is slightly
sensitive to visual input?
Only a few studies are available in which mice were treated with eyeglass
lenses. Barathi et al.
21
treated 100 albino mice with –10 D lenses for up to
322 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 322
46 days, and induced an increase in axial length of up to about 0.37 mm
and myopia of 14 D — the largest effect ever observed in mice. These lenses
had even stronger effects than lid suture over the same treatment period,
but non-visual effects of lid suture on the geometry of the anterior segment
of the eye are always possible. Faulkner et al.
65
used –10 D lenses in nob
mice and induced similar amounts of myopia (3–4 D) as with diffusers.
Burkhardt and Schaeffel failed to induce compensatory growth inhibi-
tion in response to treatment with positive lenses (unpublished observa-
tions, 2006). It remains uncertain whether the mouse eye can distinguish
between image diffuse, image degradation and defocus. Further studies, in
particular with positive lenses, are necessary.
In summary, the literature agrees that deprivation myopia can be
induced in mice but that the treatment duration should be several weeks
and the goggles need to be applied as early as possible (soon after eye
opening). The effects are small in most studies (few diopters and less than
50 µm axial length changes). The few studies also show that –10 D lenses
can induce myopia, but it remains to be discovered whether diffuse image
blur and image defocus are, in fact, distinguished by the mouse retina.
Refractive development in mutant mice
A few studies have already appeared in which the effects of permanent
know-out of a gene on refractive development were studied. Pardue et al.
25
found that the susceptibility to deprivation myopia was greatly enhanced
in nob mice with a mutation in the Nyx gene (lacking the ERG b-wave due
to a defect in the rod ON pathway), which is linked to congenital sta-
tionary night blindness (CSNB) in humans: about 5.5 D of myopia could
be induced in two weeks, starting at P28, compared to only about 1 D in
the respective wild-type. Nob mice had significantly lower retinal
dopamine and DOPAC levels than the wild-type and — in contrast to
the wild-type — no changes could be induced by diffuser wear. Schippert
et al.
27
found that mice lacking a functional gene for the transcription fac-
tor Egr-1 were more myopic than their heterozygous and wild-type litter-
mates. The homozygous knock-out animals also had significantly longer
eyes between P42 and P56, but approached wild-type dimensions later in
development. They showed no differences in corneal curvature or anterior
chamber depth. They also had normal optomotor responses. This suggests
that the effect of Egr-1 knock-out is surprisingly selective for axial eye
growth. That these knock-out animals were more myopic fits the idea that
323 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 323
the EGR-1 protein appears to be associated with an inhibition signal for
axial eye growth: in chickens, the protein is up-regulated when hyperopia
is induced and down-regulated when myopia is induced.
66,67
More
recently, Schippert et al.
68
presented an analysis of the retinal gene expres-
sion patterns in Egr-1 knock-out mice. Similar to Schippert et al.,
27
Zhou
et al.
69
found that an adenosine A2a receptor knock-out mouse went
through a phase of longer axial length and relative myopia, similar to what
was observed in the Egr-1 knock-out mice (between P42 and 56), but
returned to normal axial lengths later in development. Furthermore, these
authors found that myopia was accompanied by reduced collagen fibril
diameters in the sclera.
69
A more extended screening for refractive errors
in mutant mice was presented by Faulkner et al.
70
Significant refraction
differences were detected between C57Bl/6J mice (which had refractive
errors from 6.9 to 8.5 D), and nob and rd1 mice, which were about 2 D
more hyperopic, and GABAC null mice, which were about 5 D more
myopic than C57 mice. A next step would be to find out which morpho-
logical changes determine the changes in refraction. It could even be that
retinal thickness changes, related to the degenerations, underlie the
changes in measured refractions.
Pharmacological studies to inhibit axial eye growth in mice
Atropine is known as a potent inhibitor of myopia in humans and animal
models. A problem that arises if atropine is unilaterally applied in mice is
that the fellow “control” eye may also be contaminated with atropine due
to the cleaning behavior of the mice. Barathi et al.
71
have therefore used the
light-induced pupil response to probe the transfer of atropine to the fel-
low eye. They found that the contralateral light-induced pupil response
was also affected by ipsilateral atropine application, but only to a small
extent, making an inter-ocular comparison of atropine effects possible.
They also found that daily application of a single drop of 1% atropine
induced more hyperopic refractions and shorter axial lengths over time —
despite visual experience being normal. This is different from the chicken
where the effects of atropine are largely confined to a suppression of
myopia that would be induced by diffusers or negative lenses (e.g. Ref. 72).
Barathi et al.
73
have also studied the expression of muscarinic receptors in
both human and mouse sclera and their role in the regulation of scleral
fibroblasts. Further studies will show whether the eye growth inhibition
exerted by atropine is mediated through these receptors.
324 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 324
Image processing and regulation of retinal genes and proteins
Studies on the regulation of the retinal mRNA of Egr-1 by light and reti-
nal image contrast in mice showed surprisingly high sensitivity to the
changes in retinal image contrast — despite their low acuity and large
depth of field. Even if the retinal illumination was matched in the fellow
eye by using neutral density filters that had similar light attentuation as
the diffusers, the minor difference in image contrast had clear effects on
Egr-1 mRNA concentrations in the retina.
74
Furthermore, a microarray
analysis of gene expression under the same visual stimulation conditions
showed surprisingly clear transcription changes of a number of genes.
75
This shows that even minor differences in image contrast were detected.
Beuerman et al.
76
studied the role of transglutaminase 2 (TGM-2) during
the development of lens-induced myopia in albino mice. They found a sig-
nificant up-regulation of TGM-2 in the retina after eight weeks of treat-
ment, which was fully suppressed by simultaneous atropine treatment.
More recently, Beuerman et al.
77
studied retinal protein expression
following –10 D lens wear in albino mice, which induced 10.5 D relative
myopia and an axial elongation of 0.31 mm. From 200 identified proteins,
18 were significantly up-regulated and 10 were down-regulated. It is inter-
esting that one of them was a Muller cell marker (Vementin). All proteins
could be assigned to certain molecular and biological functions. It is
clear that such studies may help in identifying potential targets for
pharmacological intervention of myopia, and understanding the signalling
cascades from retina to sclera.
Summary
Despite its lower spatial resolution than would be possible based on the
size of the eye, inferior optics, and slow eye growth, the mouse seems on
its way to becoming an important model for studies on myopia. The
required technology to induce and measure experimentally induced
refractive errors is now available, and highly significant changes in those
variables could be induced by diffusers and eyeglass lens wear. Knock-out
models, lacking presumed elements of the signalling cascade translating
the output of retinal image processing into growth commands to the
sclera, have been studied and more will be introduced in the future.
Microarray analyses of retinal and scleral transcripts following alterations
in visual experience, or in knock-out models, have been presented and will
325 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 325
help to identify new pharmacological targets for inhibition of myopia.
Finally, screening of drugs against myopia may work well in mice since the
drug can be given as eye drops (not as intravitreal injection as in chickens)
and can reach retinal and scleral targets in sufficient concentrations due to
the small volume of the globe.
Acknowledgments
Supported by the German Research Council DFG-Scha 518/13-1.
References
1. Schaeffel F, Burkhardt E. (2002) Measurement of refractive state and depriva-
tion myopia in the black wild-type mouse. Invest Ophthalmol Vis Sci 43:
ARVO e-abstract 182.
2. Tejedor J, de la Villa P. (2003) Refractive changes induced by form deprivation
in the mouse eye. Invest Ophthalmol Vis Sci 44: 32–36.
3. Wallman J, Turkel J, Trachtman J. (1978) Extreme myopia produced by mod-
est change in early visual experience. Science 201: 1249–1251.
4. Norton TT. (1990) Experimental myopia in tree shrews. Ciba Found Symp
155: 178–194.
5. Wiesel TN, Raviola E. (1977) Myopia and eye enlargement after neonatal lid
fusion in monkeys. Nature 266: 66–68.
6. McFadden S, Wallman J. (1995) Guinea pig eye growth compensates for
spectacle lenses. Invest Ophthalmol Vis Sci 36: S758 (ARVO abstract).
7. Remtulla S, Hallett PE. (1985) A schematic eye for the mouse, and compar-
isons with the rat. Vision Res 25: 21–31.
8. Schaeffel F. (2008) The mouse as a model for myopia, and optics of its eye.
In: L Chalupa & RW Williams (eds), Eye, Retina and Visual System of the
Mouse, pp 73–87. MIT Press.
9. Porciatti V, T Pizzorusso, L Maffei. (1999) The visual physiology of the wild
type mouse determined with pattern VEPs. Vision Res 39: 3071–3081.
10. de la Cera EG, Rodriguez G, Llorente L, et al. (2006). Optical aberrations in
the mouse eye. Vision Res 46: 2546–2553.
11. Carter-Dawson LD, LaVail MM. (1979) Rods and cones in the mouse
retina. I. Structural analysis using light and electron microscopy. J Comp
Neurol 15: 245–262.
12. Oyster CW. (1999) The Human Eye: Structure and Function, chapter 15.
Sinauer Associates, Inc. Sunderland, Massachusetts.
326 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 326
13. Dangata YY, Findlater GS, Kaufman MH. (1995) Morphometric analysis of
myelinated fiber composition in the optic nerve of adult C57BL and CBA
strain mice and (C57BL x CBA) F1 hybrid: A comparison of interstrain
variation. J Anat 186: 343–348.
14. Schmucker C, Seeliger M, Humphries P, et al. (2005) Grating acuity at differ-
ent luminances in wild-type mice and in mice lacking rod or cone function.
Invest Ophthalmol Vis Sci 46: 398–407.
15. Schmucker C, Schaeffel F. (2004) A paraxial schematic eye model for the
growing C57BL/6 mouse. Vision Res 44: 1857–1867.
16. Schaeffel F, Howland HC. (1988) Visual optics in normal and ametropic
chickens. Clin Vis Sci 3: 83–98.
17. Zhou G, Williams RW. (1999) Eye1 and Eye2: gene loci that modulate eye size,
lens weight, and retinal area in the mouse. Invest Ophthalmol Vis Sci 40:
817–825.
18. Zhou X, Shen M, Xie J, et al. (2008) The development of the refractive status
and ocular growth in C57BL/6 mice. Invest Ophthalmol Vis Sci 49: 5208–5214
19. Zhou X, Xie J, Shen M, et al. (2008) Biometric measurement of the mouse
eye using optical coherence tomography with focal plane advancement. Vis Res
48: 1137–1143.
20. Tkatchenko TV, Shen Y, Tkatchenko AV. (2010) Analysis of postnatal eye
development in the mouse with high-resolution animal MRI. Invest
Ophthamol Vis Sci 51: 21–27.
21. Barathi VA, Boopathi VG, Yap EPH, Beuerman RW. (2008) Two models of
experimental myopia in the mouse. Vision Res 48: 904–916.
22. Schaeffel F, Burkhardt E, Howland HC, Williams RW. (2004) Measurement of
refractive state and deprivation myopia in two strains of mice. Optom Vis Sci
81: 99–110.
23. Jiang L, Schaeffel F, Zhou X, et al. (2009) Spontaneous axial myopia and
emmetropization in a strain of wild-type guinea pig (Cavia porcellus). Invest
Ophthalmol Vis Sci 50: 1013–1019.
24. Howlett MH, McFadden SA. (2006) Form deprivation myopia in the guinea
pig (Cavia procellus). Vision Res 46: 267–283.
25. Pardue MT, Faulkner AE, Fernandes A, et al. (2008) High susceptibility to
experimental myopia in a mouse model with a retinal ON pathway defect.
Invest Ophthalmol Vis Sci 49: 706–712.
26. Glickstein M, Millodot M. (1970) Retinoscopy and eye size. Science 168:
605–606.
27. Schippert R, Burkhardt E, Feldkaemper M, Schaeffel F. (2007) Relative axial
myopia in an EGR-1 (ZENK) knock-out mouse. Invest Ophthalmol Vis Sci 48:
11–17.
28. Schaeffel F, Howland HC, Farkas L. (1986) Natural accommodation in the
growing chicken. Vision Res 26: 1977–1993.
327 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 327
29. Schaeffel F, Wagner H. (1996) Emmetropization and optical development in
the eye of the barn owl (Tyto alba). J Comp Physiol A 178: 717–734.
30. Tkatchenko AV, Tkatchenko TV. (2009) Analysis of postnatal mouse eye
growth and plasticity with high-resolution small animal MRI. Invest
Ophthalmol Vis Sci 50: #3938 (ARVO abstract).
31. Faulkner AE, Kim MK, Iuvone PM, Pardue MT. (2007) Head-mounted gog-
gles for murine form deprivation myopia. J Neurosci Methods 161: 96–100.
32. Li T, Howland HC, Troilo D. (2000) Diurnal illumination patterns affect the
development of the chick eye. Vision Res 40: 2387–2393.
33. Beuerman RW, Barathi A, Weon SR, Tan D. (2003). Two models of experi-
mental myopia in the mouse. Invest Ophthalmol Vis Sci ARVO e-abstract 4338.
34. Drager UC. (1975) Receptive fields of single cells and topography in mouse
visual cortex. J Comp Neurol 160: 269–290.
35. Mathis U, Schaeffel F, Howland HC. (1988) Visual optics in toads (Bufo
americanus). J Comp Physiol A 163: 201–213.
36. Schaeffel F, Hagel G, Eikermann J, Collett T. (1994) Lower-field myopia and
astigmatism in amphibians and chickens. J Opt Soc Am A 11: 487–495.
37. Schaeffel F, Mathis U. (1991) Underwater vision in semi-aquatic European
snakes. Naturwissenschaften 78: 373–375.
38. Pennesi ME, Lyubarsky AL, Jr Pugh EN. (1998) Extreme responsiveness of the
pupil of the dark-adapted mouse to steady retinal illumination. Invest
Ophthalmol Vis Sci 39: 2148–2156.
39. Woolf D. (1956) A comparative cytological study of the ciliary muscle.
Anatomical Record 124: 145–163.
40. Smith SS, Sundberg JP, John SWM. (2002) The anterior segment and ocular
adnexae. In: RS Smith (ed), Systematic Evaluation of the Mouse Eye: Anatomy,
Pathology and Biomethods, pp 3–24. CRC Press LLC, Boca Raton.
41. Lorente de No R. (1933) The interaction of the corneal reflex and vestibular
nystagmus. Am J Physiol CIII: 704–711.
42. Pachter BR, Davidaowitz J, Breinin GM. (1976) Morphological fiber types of
retractor bubli muscle in mouse and rat. Invest Ophthalmol 15: 654–657.
44. Howland HC, Sayles N. (1985) Photokeratometric and photorefractive meas-
urements of astigmatism in infants and young children. Vision Res 25: 73–81.
45. Fernandes A, Yin H, Byron EA, et al. (2004) Effects of form deprivation on eye
size and refraction in C57BL/6J mouse. Invest Ophthalmol Vis Sci 45: ARVO
e-abstract 4280.
46. Schmucker C, Schaeffel F. (2004) In vivo biometry in the mouse eye with low
coherence interferometry. Vision Res 44: 2445–2456.
47. Puk O, Dalke C, Favor J, et al. (2006) Variations of eye size parameters among
different strains of mice. Mamm Genome 17: 851–857.
48. Artal P, Herreros de Tejada P, Munoz Tedo C, Green DG. (1998) Retinal image
quality in the rodent eye. Vis Neurosci 15: 597–605.
328 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 328
49. Birch D, Jacobs GH. (1979) Spatial contrast sensitivity in albino and
pigmented rats. Vision Res 19: 933–938.
50. Schmucker C, Schaeffel F. (2006) Contrast sensitivity of wild-type mice wear-
ing diffusers or spectacle lenses, and the effect of atropine. Vision Res 46:
678–687.
51. Prusky GT, West PW, Douglas RM. (2000) Behavioral assessment of visual
acuity in mice and rats. Vision Res 40: 2201–2209.
52. Wong AA, Brown RE. (2006) Visual detection, pattern discrimination and
visual acuity in 14 strains of mice. Genes Brain Behav 5: 389–403.
53. Prusky GT, Alam NM, Beekman S, Douglas RM. (2004) Rapid quantification
of adult and developing mouse spatial vision using a virtual optomotor sys-
tem. Invest Ophthalmol Vis Sci 45: 4611–4616.
54. Prusky GT, Alam NM, Douglas RM. (2006) Enhancement of vision by
monocular deprivation in adult mice. J Neurosci 26: 11554–11561.
55. Douglas RM, Alam NM, Silver BD, et al. (2005) Independent visual threshold
measurements in the two eyes of freely moving rats and mice using a virtual-
reality optokinetic system. Vis Neurosci 22: 677–684.
56. Umino Y, Solessio E, Barlow RB. (2008) Speed, spatial and temporal tuning of
rod and cone vision in mouse. J Neurosci 28: 189–198.
57. Puk O, Dalke C, Hrabé de Angelis M, Graw J. (2008) Variation of the response
to the optokinetic drum among various strains of mice. Front Biosci 13:
6269–6275.
58. Prusky GT, Douglas RM. (2004) Characterization of mouse cortical spatial
vision. Vision Res 44: 3411–3418.
59. Valmaggia C, A Rütsche, A Baumann, et al. (2004) Age related change of opto-
kinetic nystagmus in healthy subjects: a study from infancy to senescence. Br
J Ophthalmol 88: 1577–1581.
60. Thaung C, Arnold K, Jackson IJ, Coffey PJ. (2002) Presence of visual head
tracking differentiates normal sighted from retinal degenerate mice. Neurosci
Lett 325: 21–24.
61. Alphen van B, Winkelman BHJ, Frens MA. (2009) Age- and sex-related
differences in contrast sensitivity in C57BL/6 mice. Invest Ophthalmol Vis Sci
50: 2451–2458.
62. Faulstich M, van Alphen AM, Luo C, et al. (2006) Oculomotor plasticity
during vestibular compensation does not depend on cerebellar LTD.
J Neurophysiol 96: 1187–1195.
63. Abdeljalil J, Hamid M, Abdel-Mouttalib O, et al. (2005) The optomotor
response: a robust first-line visual screening method for mice. Vision Res 45:
1439–1446.
64. Sterling P. (2003) How retinal circuits optimize the transfer of visual infor-
mation. In: LM Chalupa & JS Werner (eds), The Visual Neurosciences, Vol 1,
pp 234–259. MIT press, Cambridge, Massachusetts.
329 The Mouse Model of Myopia
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 329
65. Faulkner AE, Pozdeyev N, Iuvone PM, Pardue MT. (2009) The effect of lens
defocus versus form deprivation on refractive status and dopamine in Nob
mice. Invest Ophthalmol Vis Sci 50: #3846 (ARVO abstract).
66. Fischer AJ, McGuire JJ, Schaeffel F, Stell WK. (1999) Light- and focus-depend-
ent expression of the transcription factor ZENK in the chick retina. Nat
Neurosci 2: 706–712.
67. Bitzer M, Schaeffel F. (2002) Defocus-induced changes in ZENK expression in
the chicken retina. Invest Ophthalmol Vis Sci 43: 246–252.
68. Schippert R, Schaeffel F, Feldkaemper M. (2009) Microarray analysis of
retinal gene expression in Egr-1 knock-out mice. Mol Vis 15: 2720–2739.
69. Zhou X, Huang Q, An J, et al. (2009) The relative myopia in mice deficient in
adenosine A2a receptors is associated with reduced collagen synthesis in
sclera. Invest Ophthalmol Vis Sci 50: #3839 (ARVO abstract).
70. Faulkner AE, Choi HY, Kim MK, et al. (2007) Retinal defects influenece
unmanipulated refractive development in mice. Invest Ophthalmol Vis Sci
48: #4419 (ARVO abstract).
71. Barathi VA, Beuerman RW, Schaeffel F. (2009) Effect of unilateral topical
atropine on binocular pupil responses and eye growth in mice. Vision Res
49: 383–387.
72. Diether S, Schaeffel F, Lambrou GN, et al. (2007) Effects of intravitreally and
intraperitoneally injected atropine on two types of experimental myopia in
chicken. Exp Eye Res 84: 266–274.
73. Barathi VA, Weon SR, Beuerman RW. (2009) Expression of muscarinic recep-
tors in human and mouse sclera and their role in the regulation of scleral
fibroblast proliferation. Mol Vis 15: 1277–1293.
74. Brand C, Burkhardt E, Schaeffel F, et al. (2005) Regulation of Egr-1, VIP, and
Shh mRNA and Egr-1 protein in the mouse retina by light and image quality.
Mol Vis 11: 309–320.
75. Brand C, Schaeffel F, Feldkaemper M. (2007) A microarray analysis of retinal
transcripts that are controlled by retinal image contrast in mice. Mol Vis 13:
920–932.
76. Beuerman RW, Barathi VA, Rhuan WS, Chew J. (2009) Role of transglutam-
inase 2 (TGM-2) in mouse after induction of experimental myopia. In:
McBrien, et al. Myopia: Recent advances. Opt Vis Sci 86: 45–66.
77. Beuerman RW, Barathi A, Zhou L. (2009) Quantitative analysis of the retina
proteome in a mouse model of myopia. Invest Ophthalmol Vis Sci 50: #3830
(ARVO abstract).
78. Green DG, Powers MK, Banks MS. (1980) Depth of focus, eye size and visual
acuity. Vision Res 20: 827–823.
330 F. Schaeffel
b846_Chapter-4.3.qxd 4/8/2010 2:02 AM Page 330
Gene Analysis in Experimental Animal
Models of Myopia
Roger W. Beuerman*
,†,‡,¶
, Liang K. Goh
§
and Veluchamy A. Barathi*
Progress in understanding the biological basis of myopia has taken advantage
of various animal models with the implicit suggestion that some of the results
may be passed on to studies of human myopia as a conduit to narrow the
search for genes underlying myopia. As the number of genes is not really the
differentiating factor, but rather the proteins, we try to answer the question:
“Can the results of animal studies add to our understanding of human
myopia”? This chapter provides information to support the notion that
animal models are valuable for their insights into the mechanisms of myopia,
which may facilitate the search for the genetic basis of myopia in humans.
Introduction
As discussed in Chapter 3.2 “Twin Studies and Myopia,” the insights from
twin studies do suggest that heritability must be considered as an underlying
factor in the development of myopic refractive errors. Thus, a number of
studies have been published searching for genes so that at present there are at
least 18 possible loci on 15 different chromosomes associated with myopia,
although confirming evidence has not yet been presented for all loci.
1
As
animals are not known in general to develop myopia naturally (although
some animals are maybe naturally myopic), it is unlikely that there are
somatic gene mutations that give rise to the experimental outcomes.
331
4.4
*Singapore Eye Research Institute. E-mail: [email protected]

Duke-NUS SRP Neuroscience and Behavioral Disorders.

Ophthalmology, Long Loo Lin School of Medicine.
§
Duke-NUS SRP Cancer and Stem Cell Biology.

Corresponding author: Singapore Eye Research Institute.
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 331
A Brief Introduction to Comparative Genomics
It may not be immediately clear as to what can be accomplished by finding
genes in animals associated with experimental myopia. In this “omics” era,
the number of genes in a species has been bantered about as something
associated with the more advanced the organism, which we normally
consider to be humans and their closest relatives, the apes and other non-
human primates. Indeed, the number of human genes had been variously
projected to be from 20,000 to over 100,000. Now it is fairly clear that
mammals have about 30,000 protein encoding genes,
2
which brings parity
to the initial consideration of the genome of apparently diverse species
such as the mouse and human. To make full use the mouse genome to
uncover homologies, an important goal has been to delineate and develop
catalogs of the protein encoding genes of several species. Recently, more
interest has developed in the chicken genome due to its prominence in
agriculture as well as biological sciences.
3
However, it can be said that the
chicken genome is smaller than either the mouse or human, but there
are 39 chromosome pairs, with 20 in the mouse and 23 in humans.
4,5
Functional gene encoding of proteins is, however, important for the value
of animal models, as the somatic mutation, unless aided by a specific
knock-out, will be missing. With some understanding of what protein
similarities can be expected, the animal model becomes more or less use-
ful. By comparison with other species, such as mouse and chicken where
the emphasis is on similarities between the species with the human
genome, work on the non-human primate genome, and in particular the
chimpanzee, has concentrated on differences. The genome is about the
same size, but other great apes have an additional pair of chromosomes, 48
compared to 46 for humans, but other monkeys have a variable number of
chromosomes. Protein homologs were found to differ by on average only
two amino acids. A recent study found that the genome-wide nucleotide
divergence between chimpanzee and human was only 1.23%.
6
Comparative Expression
The foregoing points to the fact that gene numbers are not the source of
the phenotypes between mammals but rather differences in their expres-
sion at the protein level. The complexities multiply at the protein level;
gene protein interactions can control genes, and one to several proteins
332 R.W. Beuerman, L.K. Goh and V.A. Barathi
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 332
can be produced by adjunct mechanisms such as alternative splicing or
post-translational processing. Clearly, these mechanisms that control the
eventual final expression are species specific. However, genes act in net-
works, as the gene products activate other genes, which often remain
poorly defined even after a gene is defined, and in experimental models of
myopia, the work most often concentrates on particular proteins associ-
ated with some specific aspect of the biological process. Therefore, despite
the knowledge of all potential gene homologies and numbers, it is an addi-
tional task to examine and to correlate the transcriptome between species.
Due to the utilitarian value of the mouse, much of the effort has been
to examine transcription between these two species. When a panel of
79 human and 61 mouse tissues were subjected to custom expression
arrays that included over 44,000 unique human and 36,000 mouse
transcripts, the authors found that 52% and 59% of human and mouse
transcripts were found in at least one tissue.
7
The comparison of the
human and mouse genome is not yet finished and a recent innovative
approach began with a gene discovery method starting with a statistical
analysis of sequence alignment for gene prediction.
8
However, with the vast amount of public databases, it has been neces-
sary to examine these for consistency of the representation of genes,
transcripts, and proteins between human and mouse. A large-scale
network, the collaborative consensus coding sequence (CCDS) project has
identified 20,159 human and 17,707 mouse consensus coding regions
from approximately the same number of genes.
9
This new CCDS database
found that at least 77% of mouse genes have a homologous human gene
and should be a major resource for those working on myopia and who
intend to make available for human gene searches the results from mouse
studies.
While there are apparently about 2.5–3 billion base pairs distributed
among about 30,000 genes in mammals, there are significant phenotype
differences between the mammalian species in general and those used for
myopia studies. However, there are some differences in the number and
homologies of genes, which may also contribute to the inter-species dif-
ferences along with complexities due to factors such as changes in dupli-
cated genes, alternate splicing, and post-translational modifications,
which are not universal across mammals. Therefore, an important origin
of these differences must be examined in the makeup of the genes, and the
ultimate form their expression-protein products. A triplet base sequence
provides the amino acid code or codon that is universal, but for most
333 Gene Analysis in Experimental Myopia
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 333
amino acids there is more than one codon. Moreover, mitochondrial
coding is different.
The strategy then becomes directed toward making information from
experimental myopia studies that contribute specific genes of functional
interest, which could be passed along to those working with human
samples to provide data for more focused candidate gene studies.
Genes in Retina and Sclera in Animal Models of Myopia
The finding of Zhou and Williams (1999) that eye weight is a heritable
trait in various species of mice was independent of body weight or brain
size, but the correlation to the retinal area was high.
10
Within the 50 strains
of mice that were examined, both overall weight and lens weight, as well as
the number of retinal ganglion cells showed strain specific variations.
As the mouse eye continues to grow past sexual maturity, a mouse oppor-
tunities to examine and modify growth with correlative molecular and
cellular data could be presented. A somewhat similar study in three strains
of chickens found that eye size did not vary, but induced changes in axial
length due to posterior chamber elongation varied between strains.
11
However, the strain differences appeared to be overcome by within from
species differences.
ZENK (EGR-1)
Early gene expression studies in association with experimental myopia
were all centered on the chick model as that has been prominent and
primarily focused on using mRNA and Northern blots of retina for
analysis. However, these papers did uncover interesting candidates such as
sonic hedgehog, among a few possible genes that were examined.
12,13
Sonic
hedgehog continues to be of interest in developmental anomalies of eye
and brain. Although this was present in the retina in a few cases, bone
morphgenetic protein (BMP4) was more associated with myopia.
14
Work
on association of ZENK in glucagon containing amacrine cells, the avian
homolog of EGR-1 — an early immediate gene and transcription factor
whose protein is a member of the C
2
H
2
-type zinc-finger proteins — was
discovered.
15,16
Acting as a nuclear protein, Egr-1 is involved in the activa-
tion of genes required for differentiation and mitogenesis. Schaeffel and
334 R.W. Beuerman, L.K. Goh and V.A. Barathi
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 334
colleagues were examining the retinoic acid system, some of which had a
relationship to some aspects of modifying the visual input.
In 2008, using the Affymetrix GeneChip Chicken Genome with more
than 28,000 entries, Schippert, Schaeffel, and Feldkaemper were able to
find 16 candidate genes that were differentially expressed and were further
assessed by real-time PCR.
17
Of the 16 genes, six were found to respond
similarly to either positive or negative lenses, and three genes responded
differentially to the presence of positive or negative lenses. In this study,
lenses were worn for only a short time,
24
but the implication was that novel
gene programs were set into motion by short defocus on the retina. It is
not clear how these signals could be transmitted to the sclera or if there
were other gene programs set into motion in the sclera. However, it was
found that six genes mapped to regions that were already known to be
associated with families of human myopes. Due to the short time period
of the modification of light input, perhaps ZENK would not be expected
to appear.
ZENK was also found to respond to pharmacological control by
atropine (muscarinic antagonist) and a dopamine agonist. These were
injected in small amounts intravitreally in the chick eye just prior to fitting
diffusers over the eye. These agents reversed the down regulation of ZENK
due to diffusers alone.
18
Relating the chick results with ZENK to mammals has been shown by
examining the development of the eye in an EGR-1 knockout mouse. Eye
growth and refractive error were followed by measuring the corneal radius
of curvature along with refractive state and ocular dimersions.
19
A myopic
shift was found in the eyes of the knockout animals, and although changes
declined with age, the myopic shift remained.
Thus, the situation with animal models of myopia is not substantially
better than with the many gene candidates found in human studies. A sub-
stantial benefit has been the development of arrays for the chick. This is
valuable as the chick model shows rapid myopic changes in response to
modification of the visual input, and the eye is larger than the mouse, eas-
ing the technical hurdles.
Scleral Gene Expression in a Mouse Model of Myopia
The emphasis in all these studies has been on the retina, despite the real-
ization that growth processes producing the posterior chamber elongation
335 Gene Analysis in Experimental Myopia
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 335
and myopia are located in the sclera. We have shown that two models of
experimental myopia can be developed in Balb/cJ mice
20,21
and also from
two other groups.
22,23
We determined that all five muscarinic receptor sub-
types expressed in mouse sclera and RPE similar to human.
24,25
In another
study, we showed that the M1, M4, and M5 muscarinic receptor knock-out
(KO) mice eye grew 200 µm longer than M2 and 220 µm longer than M3
knock-out mice.
26
These results provide initial evidence that M1, M4, and
M5 receptors may contribute more than the M2 and M3 receptor in terms
of scleral growth in experimental myopia.
We have chosen to examine the sclera despite some technical issues,
such as the ability to extract sufficient target from a single mouse sclera
so that direct experimental-contra-lateral control comparisons can be
made, thus increasing our statistical power. Pregnant Balb/cJ mice (Mus
musculus) were obtained from the animal holding unit of the National
University of Singapore. Animals gave birth in our animal holding unit.
Naive control animals were housed in groups of six, while experimental
animals were housed individually in standard mouse cages after 28 days
of age at 25°C on a schedule of 12:12 hours of light on and off
with mouse pellets and water available ad libidum. Approval was obtained
from the SingHealth IACUC and all procedures performed in this study
complied with the Association of Research in Vision and Ophthalmology
(ARVO) Statement for the Use of Animals in Ophthalmology and Vision
Research. Procedures for myopia induction and data analysis for biome-
try measurements were as previously published.
21
RNA, Target cDNA and Microarray Chip Preparation
Total RNA was isolated from a single mouse sclera (n = 6 at each time
point) using MELT
TM
Total Nucleic Acid Isolation System (Ambion Inc.,
Austin, TX) according to the manufacturer’s instructions. RNA concentra-
tion and quality were assessed by absorbance at 260 nm and the
absorbance ratio of 260/280 respectively using Nanodrop® ND-1000
Spectrophotometer (Nanodrop Technologies, Wilmington, DE). cDNAs
were synthesized and labeled with biotin using Genechip® Whole
Transcript Sense Target Labeling Assay (Affrymetrix, Inc., Santa Clara,
CA). Biotin-labeled cDNA were then hybridized to a Mouse Gene 1.0 ST
array for naive samples and MOE gene expression chips for −10 D eyeglass
lens treated and control samples (Affrymetrix, Inc., Santa Clara, CA) using
336 R.W. Beuerman, L.K. Goh and V.A. Barathi
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 336
Genechip® Hybridzation kit (Affrymetrix, Inc., Santa Clara, CA). The
microarray chips were washed and stained using Genechip®
Hybridization, Wash and Stain kit (Affrymetrix, Inc., Santa Clara, CA).
Subsequently, the microarray chips were scanned using Genechip®
Scanner 3000 7G (Affrymetrix, Inc., Santa Clara, CA).
Microarray Data Analysis
The microarray data (cel.files) were imported into Partek Genomic Suite
6.5 beta (Partek. Inc., Louis, MO) and normalized using GC-RMA. The
variability of all samples was assessed using PCA plot (Fig. 1), and a Venn
diagram (Fig. 2) was generated to compare the differentially expressed
337 Gene Analysis in Experimental Myopia
Figure 1. PCA plot shows clustering of gene expression in mouse sclera at one week (T0),
two weeks (T1), and eight weeks (T2) after eyeglass lens induced myopia and control sclera.
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 337
genes found among the age groups. Furthermore, the gene profiles of all
samples were hierarchically clustered based on gene expression (Fig. 3).
ANOVA analysis (P < 0.05) was performed on the data and a set of genes
was selected using a two-fold change threshold. The set of genes was
then further grouped into a biological process, cellular component, and
molecular function using Gene Ontology enrichment. The Gene Ontology
enrichment score for each functional group is calculated using the Chi-
square test, and a bar chart was generated. In addition, a forest plot
showing the gene expression of each functional group was also generated.
Scleral Gene Expression in the Myopic Mouse
Three time points for the induction of myopia have been tested thus far:
T0 (week 1), T1 (week 2), and T2 (week 8). At each time point, batch
338 R.W. Beuerman, L.K. Goh and V.A. Barathi
Figure 2. Venn diagram shows the differentially expressed genes found among the age groups.
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 338
removal was applied, and then gene expression from these time points
were combined for analyses. Principal component analysis (Fig. 1) showed
clustering of gene expression. T0 and the control were clustered together
as might be expected. Sources of variation indicated gene expression was
the major signal.
339 Gene Analysis in Experimental Myopia
Figure 3. Gene profiles of all samples were hierarchically clustered based on gene expression.
Figure 4. Selected up and down regulated gene expression in sclera after six weeks of eyeglass
lens myopic induction compared to sclera of the contra-lateral control eye.
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 339
Significant genes that were shown to have significant differential
expression between different time points were selected for gene expression
validation. Real time PCR primers were designed using ProbeFinder
2.45 (Roche Applied Science, IN). Mouse 18srRNA gene was used as
control due to its constant expression level across the age group.
Summary
These are early stage results and with human studies will require valida-
tion in other laboratories. Microarray studies of mouse myopic sclera
showed the significant up-regulation of TGM (transglutaminase) 1, 2, 5,
MMP-14 (matrix metalloproteinase), 19, Collagen 5a3, a2, MAPK 8, and
down-regulation of TGM 3, FBN1 (fibrillin 1) as compared to control
sclera after six weeks induction of spectacle lens induced myopia (Ref. 27;
Fig. 4). These are all genes with homologies to human gene expression.
Previous studies have shown the expression that TGF-beta 1 is down-
regulated in the tree shrew sclera, which suggested a contribution to
greater extensibility.
28
Mice with M1 and M5 receptor knock-out expressed more TGM2
in scleral fibroblasts (SF) than knock-outs for M2, M3 in KO and WT
mice SFs mRNA levels (Fig. 5). TGM2, also known as tissue transgl-
utaminase, is expressed ubiquitously. The primary function of TGM2 is
transamidation and requires calcium as a cofactor. Interestingly,
340 R.W. Beuerman, L.K. Goh and V.A. Barathi
Figure 5. Expression of TGM-2 in muscarinic receptor mutant mice sclera.
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 340
transcription is increased by retinoic acid. Amongst its many supposed
functions, it appears to play a role in wound healing, apoptosis and extra-
cellular matrix development. However, for its role in the myopic sclera,
TG2 also has GTPase activity and in the presence of GTP it is suggested to
function as a G protein participating in signaling processes. These results
suggest that M1, M5 KO axial growth was higher than the M2, M3 KO
and WT mice. Based on these results, TGM2 and muscarinic receptors
interaction could be involved in scleral remodeling.
References
1. Jacobi FK, Pusch CM. (2010) A decade in search of myopia genes. Front Biosci.
15: 359–372.
2. Lander ES, Linton LM, Birren B, et al. (2001) Nature 409: 860–921.
3. Aerts J, Crooijmans R, Cornelissen S, et al. (2003) Integration of chicken
genome resources to enable whole-genome sequencing. Cytogenet Genome
Res 102: 297–303.
4. Burt DW, Bruley C, Dunn IC, et al. (1999) The dynamics of chromosome
evolution in birds and mammals. Nature 402: 411–413.
5. International Chicken Genome Sequencing Consortium (ICGSC). (2004)
Sequence and comparative analysis of the chicken genome provide unique
perspectives on vertebrate evolution. Nature 432: 695–716.
6. The Chimpanzee Sequencing and Analysis Consortium. (2005) Initial
sequence of the chimpanzee genome and comparison with the human
genome. Nature 437: 70–87.
7. Su AI, Wiltshire T, Batalov S, et al. (2004) A gene atlas of the mouse and human
protein-encoding transcriptomes. Proc Nat Acad Sci, USA 101: 6062–6067.
8. Guigo R, Dermitzakis ET, Agarwal R, et al. (2003) Comparison of mouse and
human genomes followed by experimental verification yields an estimated
1019 additional genes. Proc Nat Acad Sci, USA 100: 1140–1145.
9. Pruitt KD, Harrow J, Harte RA, et al. (2009) The consensus coding sequence
(CCDS) project: identifying a common protein-coding gene set for the
human and mouse genomes. Genome Res 19(7): 1316–1323.
10. Zhou G, Williams RW. (1999) Mouse models for the analysis of myopia: an
analysis of variation in eye size of adult mice. Optom Vis Sci 76: 408–418.
11. Guggenheim JA, Erichsen JT, Hocking PM, et al. (2002) Similar genetic
susceptibility to form-deprivation myopia in three strains of chickens. Vis Res
42: 2747–2756.
12. Escano MF, Fuji S, Sekiya Y, et al. (2000) Expression of Sonic hedgehog and
retinal opsin genes in experimentally induced myopic chick eyes. Exp Eye Res
7: 459–467.
341 Gene Analysis in Experimental Myopia
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 341
13. Akamatsu S, Fuji S, Escano MF, et al. (2001) Altered expression of genes in
experimentally induced myopic chick eyes. Jpn J Ophthalmol 45: 137–143.
14. Bakrania P, Efthymiou M, Klein JC, et al. (2008) Mutations in BMP4 cause
eye, brain and digit developmental anomalies: overlap between the BMP4 and
hedgehog signaling pathways. Am J Genetics 82: 304–319.
15. Fischer AJ, McGuire JJ, Schaeffel F, Stell WK. (1999) Light- and focus-dependent
expression of the transcription factor ZENK in the chick retina. Nat Neurosci
2: 706–712.
16. Bitzer M, Feldkaemper M, Schaeffel F. (2000) Visually induced changes in
components of the retinoic acid system in fundal layers of the chick. Exp Eye
Res 70: 97–106.
17. Schippert R, Schaeffel F, Feldkaemper MP. (2008) Microarray analysis of
retinal gene expression in chicks during imposed myopic defocus. Mol Vis 14:
1589–1599.
18. Asby R, McCarthy CS, Maleszka R, et al. (2007) A muscarinic cholinergic
antagonist and a dopamine agonist rapidly increase ZENK mRNA expression
in the form-deprived chicken retina. Exp Eye Res 85: 15–22.
19. Schippert R, Burkhardt E, Feldkaemper M, Schaeffel F. (2007) Relative axial
myopia in EGR-1 (ZENK) Knockout mice. Invest Ophthalmol Vis Sci 48: 11–17.
20. Beuerman RW, Barathi A, Weon SR, Tan D. (2003) Two models of experi-
mental myopia in the mouse. Invest Ophthalmol Vis Sci 44(Suppl): 4338.
21. Barathi VA, Boopathi VG, Yap EPH, Beuerman RW. (2008) Two models of
experimental myopia in the mouse. Vis Res 48(7): 904–916.
22. Tejedor J, de la Villa P. (2003) Refractive changes induced by form deprivation
in the mouse eye. Invest Ophthalmol Vis Sci 44(1): 32–36.
23. Schaeffel F, Burkhardt E, Howland HC, Williams RW. (2004) Measurement of
refractive state and deprivation myopia in two strains of mice. Optom Vis Sci
81(2): 99–110.
24. Barathi VA, Weon SR, Kam JH, et al. (2007) Experimental myopia in
muscarinic receptor knockout mice: role of specific muscarinic receptor
subtypes. Invest Ophthalmol Vis Sci 48(Suppl): 4418.
25. Barathi VA, Weon SR, Beuerman RW. (2009) Expression of muscarinic recep-
tors (mAChRs) in human and mouse sclera and their role in the regulation of
scleral fibroblasts proliferation. Mol Vis 15: 1277–1293.
26. Barathi VA, Weon SR, Rebekah PWY, Beuerman RW. (2008) Muscarinic
regulation of epidermal growth factor receptor in mammalian retinal
pigment epithelial (RPE) cells. Invest Ophthalmol Vis Sci 49(Suppl): 3535.
27. Beuerman RW, Barathi VA, Weon SR, et al. (2008) Expression of transgluta-
minase 2 in mouse sclera in experimental myopia. Invest Ophthalmol Vis Sci
49(Suppl): 3718.
28. Jobling AI, Gentle A, Metapally R, et al. (2009) Reulation of scleral cell con-
traction by transforming growth factor-B and stress. J Biol Chem 284:
2072–2079, 2009.
342 R.W. Beuerman, L.K. Goh and V.A. Barathi
b846_Chapter-4.4.qxd 4/8/2010 2:03 AM Page 342
Interventions for Myopia
Section 5
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 344
This page intentionally left blank This page intentionally left blank
345
Atropine and Other Pharmacological
Approaches to Prevent Myopia
Louis M.G. Tong*
,†,‡
, Veluchamy A. Barathi and
Roger W. Beuerman
†,§
Introduction
An earlier chapter (Chapter 1.1) in this book has mentioned the rising inci-
dence of myopia in many countries, and that myopia may occur at a relatively
young age (prior to 10 years) and then stabilizing at 16 years or younger.
When myopia stabilizes at higher severities, e.g., at greater than 6 D, there is
a risk of potential blinding conditions such as retinal detachment, retinal
degeneration and glaucoma (Chapters 2.3, 2.4 and 2.5). Higher severity of
myopia induces morbidity by increasing the aberrations and reducing qual-
ity of life (Chapter 2.1). For these reasons, it is important to attempt to arrest
the progression of myopia, or even stop the onset of myopia.
Historically, many forms of treatment to arrest myopia have been
attempted,
1
as early as in the 19th century.
2
Currently, there is no general
guideline followed by eye care practitioners for interventions that may
decrease myopia in children. Recently, the authors have published review
articles on the common modalities that have been advocated for myopia
treatment.
3,4
Apart from pharmacological therapies, these modalities
include optical treatment such as changing the pattern of spectacle wear,
5,6
the use of bifocals, multifocals and RGP contact lenses,
7,8
and the use
5.1
*Singapore National Eye Centre. E-mail: [email protected]

Singapore Eye Research Institute, Singapore.

Duke-NUS Graduate Medical School, Singapore.
§
Duke–NUS, SRP Neuroscience and Behavioral Disorders, Ophthalmology, Yong Loo Lin School of
Medicine, National University of Sinagapore, Singapore.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 345
of orthokeratology
9
and visual training.
10
Apart from pharmacological
therapies, and studies that show the effect of progressives on a subset of
myopia,
11,12
no other forms of treatment have been shown in randomized
controlled studies to have a beneficial effect. For this reason, this chapter
will focus only on pharmacological therapies.
The aim of this chapter is to summarize the postulated mechanisms,
historical aspects, and the current evidence for the efficacy and safety of
various pharmacological treatments to arrest myopia progression.
Possible Mechanisms of Pharmacological Treatment
The main eyedrops that have been evaluated in the treatment of human
myopia include the anti-muscarinic agents and ocular hypotensives.
Common anti-muscarinic drugs that have been evaluated include atropine,
13
pirenzepine,
14
tropicamide
15
and cyclopentolate.
16
The ocular hypotensives
that have been evaluated are the beta-adrenergic blockers labetalol and
timolol,
17
adrenaline
18
and parasympathomimetic pilocarpine.
2
Although atropine
19,20
and pirenzepine
14
have been shown to reduce
myopia progression via slowing of axial elongation, the exact mechanism
is still unknown.
Both atropine and pirenzepine are blocking agents that are effective
against muscarinic acetylcholine receptors of which there are five types,
all of which are present in ocular tissues in varying amounts.
21–23
However, pharmacologically, the use of a blocking agent is contingent on
identifying the agonist of the effective pathway. In the case of myopia, the
actual agent has not been identified and the use of atropine is historical,
based on a hypothesized role of accommodation in myopia, which has
turned out not to be the case. The second issue regarding the target of
atropine, is the location of the muscarinic cholinergic receptors. Many
ocular tissues have these receptors (Fig. 1). As shown in Fig. 2, the goal of
current research is to determine the initial site of action of atropine or
other muscarinic blockers. Locating the tissue with the critical receptor
population will be the first step in developing new therapies with better
targeting.
The muscarinic cholinergic receptors (mAChRs) are well known
members of the G-protein coupled receptor superfamily (GPCRs). The
mAChRs have both a neuronal and a non-neuronal presence, and interest
in non-neuronal applications has been expanding. It has been established
346 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 346
347 Atropine and Other Pharmacological Approaches to Prevent Myopia
that there are five types of muscarinic receptors, M
1
–M
5
.
24
Muscarinic
receptors are linked to proliferation through intracellular pathways involv-
ing the mitogen activated protein kinase (MAPK). However, in addition
and maybe importantly for myopia, there are also established interactions
between the muscarinic receptors and the growth factor receptors such
Figure 1. Immunohistochemistry of muscarinic receptor subtypes in cultured mouse (a) and
human scleral fibroblasts (b). Subtype selective antibodies bound demonstrated the
presence of the muscarinic receptors M
1
–M
5
. No binding was observed when the primary
antibody was omitted (not shown). The M
1
–M
5
receptors were localized to the cell
membrane as well as to the cytoplasm. Magnification, 200×.
Figure 2. Schematic showing the action of topical anti-muscarinic agent on myopia.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 347
348 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
as epidermal growth factor.
24
These pathways interact through the
cytoplasmic components of the pathways through various mechanisms
referred to as transactivation.
The ocular role of these receptors in accommodation has been
well-established, which is the underlying reason for the application of
atropine to prevent myopia, thought to be associated with near-work. The
two tissues that are intimately linked to myopia, the retina and sclera, are
both potential targets of muscarinic blockers. The function of mAChRs
M
1
–M
3
receptors appears to dominate. This has been the case for mam-
malian retina, retinal pigment epithelium and the lens.
25–27
The chicken
retina has also been explored for the effects of mAChRs. This has been
motivated by the finding that pirenzepine slows myopia progression in the
experimental model of myopia in the chick, suggesting a role for M
1,
as
pirenzepine has a stronger effect on this muscarinic sub-type.
28
However,
after an extensive effort it was found that the M
1
receptor does not exist in
the chick, which puts some doubt on the role of muscarinic action in the
control of sclera growth. These studies did find the presence of M
2
and M
4
.
It was found that various muscarinic antagonists, when injected into the
posterior chamber of the chick eye, changes ZENK expression, a chicken
analog of the early-immediate mammalian gene EGR–1.
29
Recent studies have demonstrated that multiple mAChRs occur in
mammals including humans associated with specific tissues.
30
The
M
3
-receptor is the main mAChR in human cornea, iris, ciliary body, and
the epithelium of the crystalline lens.
26–31
The M
2
- and M
4
-receptors have
been found in the rat retina.
32
The biology of the subtypes of mAChRs in
the eye has not been explored in detail, but at both the mRNA and protein
levels, all five mAChRs were detected in the human sclera,
21,33
tree shrew
sclera,
34
guinea pig sclera,
35
and mouse sclera
21
(Fig. 1). However, the func-
tional significance of cholinergic receptors in SFs remains to be studied in
detail.
Anti-muscarinic agents have been known to influence sclera remodel-
ing in tree shrew myopia.
23
Chapter 4.2 describes the changes in the extra-
cellular matrix of the sclera, which are known to be involved in scleral
remodeling during myopiagenesis.
Drugs such as atropine have been known to affect the release of
dopamine, which is a critical retinal neurotransmitter important for
control of the growth of the eye.
36
Atropine can also influence growth
hormone, which may exert an effect on the growth of the eye and hence
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 348
349 Atropine and Other Pharmacological Approaches to Prevent Myopia
myopia development.
37
The rationale for the use of ocular hypotensives
was that raised intraocular pressure may exert a passive stretching effect
on the sclera of the eye, contributing to axial elongation. However, there
is little evidence that supports this in the scientific literature.
Efficacy Studies
A parallel group randomized controlled study in Taiwan has shown the
efficacy of atropine in the retardation of myopia.
16
This study, however, is
not masked. Another study in Taiwan has
38
evaluated the use of various
concentrations of atropine (0.5%, 0.25%and 0.1%) in myopia. A study in
Singapore has found 1% atropine to be efficacious in the retardation of
childhood myopia.
19
Three hundred forty-six (86.5%) children completed
the 2-year study. After 2 years, the mean progression of myopia and of
axial elongation in the placebo-treated control eyes was −1.20+/−0.69 D
and 0.38+/−0.38 mm, respectively. In the atropine-treated eyes, myopia
progression was only −0.28+/−0.92 D, whereas the axial length remained
essentially unchanged as compared with the baseline (−0.02+/−0.35 mm).
The differences in myopia progression and axial elongation between the
two groups were −0.92 D (95% confidence interval, −1.10 to −0.77 D; p <
0.001) and 0.40 mm (95% confidence interval, 0.35–0.45 mm; p < 0.001),
respectively.
Despite the efficacy results of the studies employing atropine eyedrops,
numerous questions remain. One aspect that needs to be addressed is the
effect of stopping atropine eye drops. The results of the above study in
Singapore show that on stopping atropine after two years of administra-
tion, the progression rate of myopia increased in the subsequent year, as
compared with children who had placebo in the first two years.
20
In the
year after cessation of drugs, the mean progression rate in the atropine
group was –1.14+/−0.80 D, whereas the placebo group only progressed by
–0.38+/− 0.39 D (p < 0.0001). However, a beneficial effect was still evident
in the atropine group over the course of three years in the clinical trial.
At the end of three years, the spherical equivalent in the atropine group
was –4.29+/–1.67 D as compared with –5.22+/−1.38 D in the placebo
group (p < 0.0001). Importantly, after the cessation of atropine, the ampli-
tude of accommodation and near visual acuity, previously impaired,
returned to pretreatment levels.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 349
350 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
In a multicenter Asian study
14
designed to evaluate pirenzepine in
myopia, the subjects received 2% gel twice daily (gel/gel), 2% gel daily
(evening, placebo/gel), or vehicle twice daily (placebo/placebo) in the 2:2:1
ratio, respectively, for 1 year. The main OUTCOME MEASURE, like in
most studies, was the spherical equivalent under cycloplegic refraction. At
study entry, the mean SE refraction was −2.4+/−0.9 D and at 12 months,
there was a mean increase in myopia of 0.47 D, 0.70 D, and 0.84 D in the
gel/gel, placebo/gel, and placebo/placebo groups, respectively (p < 0.001
for gel/gel versus placebo/placebo).
There was only a single report of a randomized controlled parallel study
of tropicamide, which evaluated 26 pairs of twins.
39
This study, which had
a follow up period of 3.5 years, found no difference in the myopia outcome
when the results of using tropicamide 1%combined with bifocals, against
single vision glasses, respectively, were compared.
There were various other drug studies in myopia that employed cyclo-
plegics.
13,40,41
These studies, however, suffer from methodological issues
such as the lack of a control or randomization.
A study comparing the effect of timolol versus single vision spectacles
42
showed no retardation of myopia by timolol. There has been no other
controlled trials involving ocular hypotensives in myopia.
In summary, an evidence-based recommendation on the use of
atropine in myopia was considered level B (moderately important to
outcome).
4
Among the various types of pharmacological treatment in
myopia, atropine appears to be the most promising. However, some
questions remain, for example, what is the optimal dose for childhood
myopia? Could the frequency of the administration of atropine be
reduced, as an alternative to reducing the concentration of atropine.
Currently, concentrations of atropine eyedrops below 1% are not avail-
able commercially in most countries. Another issue is the overall dura-
tion of treatment. Most clinicians will want to limit the use of atropine
to as short a duration as possible. This is because theoretical side effects
like increased incidence of light-induced maculopathy and cataracts
should not be neglected. Ideally, if one can predict the time course of
myopic progression before stabilization, one can limit atropine treat-
ment to this period. In reality, however, it may not be possible to predict
with complete certainty the point of stabilization of refractive errors.
A study is ongoing in Singapore that aims to evaluate the optimal
duration of atropine treatment in myopic children.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 350
351 Atropine and Other Pharmacological Approaches to Prevent Myopia
Other Issues Related to Drugs
Treatment of myopia with bilateral atropine eyedrops has the disadvantage
of blurring near vision and so myopic children will require near optical
correction for school work and close distance visual activities. A study has
evaluated the use of atropine in combination with progressive lens.
43
This
randomized clinical trial involving 188 subjects showed that 0.5%atropine
eyedrops in combination of multifocal glasses was more effective in
retarding myopia progression as compared with those wearing multifocal
glasses or single vision glasses. The mean progression was 0.41 D per year
as compared with 1.19 D and 1.40 D per year, respectively (p < 0.0001).
Traditional Chinese medicine, or even folk medicine and other “holistic”
practices and routines have been tested in Asian countries. The only ran-
domized controlled study of this nature retrievable from the PUBMED
database was the study that used adhesive pressure plaster of Semen impa-
tientis, a garden balsam seed extract, which claimed significant therapeutic
benefit relative to control.
44
It is difficult to perform further studies or repli-
cate the results in more studies because the composition of plant extracts is
highly complex — they frequently contain unknown active ingredients,
and possess variable biological activity between batches. Myopia has
become a highly emotive public health issue in some communities.
Anecdotally, people have adopted various practices that they perceive as
beneficial. It is important, however, for the scientific community to explain
that new advances and convincing therapeutics can only be developed and
funded if they are supported by peer reviewed scientific evidence.
In the clinical trial conducted in Singapore,
19,20
buccal mucosa DNA
was collected for genotyping of five published single nucleotide poly-
morphism (SNP) loci for the human muscarinic receptor-1 gene.
45
Polymerase chain reaction (PCR) was performed to amplify a region of
the gene containing the SNP of interest (Table 1), followed by restriction
enzyme digest to generate DNA bands of differing molecular weight
when ran on gel electrophoresis. For this analysis, the subjects who
responded to atropine treatment were defined as those with progression
of spherical equivalent (cycloplegic autorefraction) of less than 0.5 D
during a period of two years. Treatment was deemed to be ineffective
when the myopia increased by more than 0.5 D. The chi square test was
used to evaluate 2×2 (in the case where two possible alleles exist at the
SNP locus) or 2×3 tables (in the case where three possible alleles exist at
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 351
352 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
the SNP locus). One hundred and twenty-two of the subjects with DNA
collection had been exposed to atropine eye drops uni-ocularly. Two out
of 122 subjects did not have two years of refractive data because of with-
drawal from the clinical trial (red eyes causing drug intolerance). When
each of the five loci was evaluated one at a time, no particular genotype
was associated with the effectiveness of atropine treatment (all p > 0.05).
However, one combinatory criterion involving the SNPs rs2067480 and
rs542269 was able to discriminate between drug responders and non-
responders (Table 2).
Table 3 shows how the genotypes at rs2067480 and rs542269 were
jointly associated with the response to atropine treatment (p = 0.033 by
Fishers exact probability test). The odds ratio of responding to the treat-
ment given a positive test on genotyping was 3.40 (95% CI: 1.07–10.82).
The test had a reasonably good specificity of 88% (95% CI: 71–96), but
sensitivity of only 32% (95% CI: 22–44), with a positive predictive value
of 85% (95% CI: 65–95), and a negative predictive value of 37% (95% CI:
27–49). Because of the limited number of subjects in a clinical trial, this
data cannot be sufficiently robust to allow multiple testing corrections and
evaluation of SNP–SNP interactions, or explore other potentially relevant
Table 1. Primers used for Polymerase Chain Reaction for Restriction Fragment Length
Polymorphism or Sequencing Analyses
Expected Annealing
Amplicon Temperature Restriction
SNP Primers Size (bp) (°C) Enzyme
rs542269 F: TTTGCAAAAGGCCTAACCTG 306 60 BslI
R: CCTCTTCCCACAGCACTGTTA
rs2067480 F: CCACCTTCTGCAAGGACTGT 403 62 NlaIV
R: CTGGGAATAGCGAAGTCTGG
rs2067477 F: CTGTCAGCCCCAACATCAC 286 65 Cfr13I
R: GCCAGCCAGAGGTCACAA
rs2067478 F: TGATCAAGATGCCAATGGTG 241 62 Alu I
R: TACGGTGTCCAGGTGAGGAT
rs1065431 F: GCTCTACTGGCGCATCTACC 307 65 MspA1I
R: GTCCACCATTGGCATCTTG
rs2075748 F: AGATCCCCCTCAGGAAACTG 295 62 Ban I
R: CACCCACCTTGGTTTCTAGC
SNP: single nucleotide polymorphism.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 352
353 Atropine and Other Pharmacological Approaches to Prevent Myopia
SNPs at the other muscarinic receptor subtypes. Nevertheless, the current
data are sufficiently interesting to suggest that SNP evaluation, as part of
pharmacogenetic testing, should be incorporated into larger drug trials in
myopia, with sample sizes that will allow sophisticated statistical proce-
dures on multi-dimensional data.
46
Potential Side Effects
The adverse effects of the use of 1% atropine has been reported to include
photophobia and reduction of outdoor activities.
16
Adverse side effects
with 0.5% atropine was relatively reduced, and no apparent photophobia
Table 2. Observed Frequency of Subjects with Various Genotypes Stratified by Myopic
Progression
Genotype at
rs2067480 (First 2 No of Subjects: SE No of Subjects: SE
Alphabets) and Worse by at Least Worse by Less Than Total
rs542269 (Third and 0.5 D 0.5 D No. of
Fourth Alphabet)* (Non-Responders) (Responders) Subjects
CCTT 25 39 64
CTTT 4 10 14
TTTT 0 1 1
CCCC 0 1 1
CCCT 4 16 20
CTCT 0 2 2
NNNC
a
0 3 3
Total 33 72 105
*Rows indicate the genotypes at the 2 loci: the first two letters represent the genotype at rs2067480
genotype at rs542269. The genotype at each locus is specified by 2 letters or bases, one for each of the
2 chromosomes. 18 subjects were found not have enough DNA to determine the allele at rs2067480,
so only 102 subjects have genotypes examined at rs2067480.
a
This genotype consists of a “C” at rs542269, which can be heterozygous or homozygous for “C”. The
genotype at rs2067480 is irrelevant for this genotype, represented by “NN” in the table. These subjects
can be included in the analysis regardless of their genotype at rs2067480, or when the genotype at
rs2067480 is not known. As a result of this qualification, 3 children’s data could be included in the
analysis, which increased the total number of children analysed to 105.
SE: spherical equivalent.
This table shows the number of subjects with the specified genotypes (in rows) that were drug respon-
ders or otherwise. The last row shows the total number of responders (72) and non-responders (33).
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 353
354 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
was observed with 0.25% and 0.1% atropine.
38
One possible side effect of
unilateral use of atropine is the resulting anisometropia, especially if the
untreated eye is rapidly progressing in myopia severity. In clinical practice,
there is an option to switch unilateral therapy to the opposite eye, or to
commence bilateral atropine treatment.
Another side effect that has been noted with 1% atropine eyedrops is
the effect of cycloplegia or reduction of near visual acuity. A study in
Singapore has shown that this complication is well tolerated largely.
19
Nevertheless, atropine eyedrops are not recommended for all myopic chil-
dren.
4
This is because the long-term potential side effects of atropine such
Table 3. Two by Two Contingency Table showing Test Result and Effectiveness of
Treatment
Non-Responders: Responders: Intervention
Intervention not Effective [SE Worsened
Effective [SE Worsened by Less Than 0.5 D
by at Least 0.5 D Over (or any Improved)
2 Years] Over 2 Years] Total
a
NEGATIVE TEST* 29 49 78
(74%)
(rs2067480: CC or
CT) and rs542269 TT
POSITIVE TEST* 4 23 27
(26%)
Any genotype not
covered above
Total
b
33 (31%) 72 (69%) 105
*The data for this 2×2 contingency table were obtained by collapsing or merging the genotypes (rows
in Table 2), the first 2 rows in Table 2 were combined to produce the genotypes representing a nega-
tive test in Table 3, and the bottom 5 rows in Table 2 have been merged to produce the positive test
genotypes. The reason for designating the genotypes in the first 2 rows as a “negative test” is that under
these circumstances the proportion of non-responders (defined as having progression of more than
0.5 D) was higher than those of the other genotypes. In the cases with genotype CCTT (Table 2, first
row), 39%were non-responders, and the cases with genotype CTTT (Table 2, second row), 29%were
non-responders, whereas in all other genotypes (Table 2, subsequent rows), only 20%or less were non-
responders.
a
Percentages in column indicate the proportion of people with negative and positive test results, not the
proportion of responders. More people obtained a negative test compared to a positive test in this trial.
b
This row indicates the percentages of responders and non-responders to treatment. More people
respond to treatment than not.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 354
355 Atropine and Other Pharmacological Approaches to Prevent Myopia
as cataract formation and retinal toxicity have not been evaluated. The
electrophysiological assessment of some patients with atropine treatment
showed little long-term effect, with the retina-on response changed more
than the retina-off response.
47
In the pirenzepine study,
14
11% (31/282) of pirenzepine-treated
subjects were discontinued from the study for adverse events.
14
There were
15 serious adverse events reported in 12 subjects (all in the active groups),
but none was ophthalmic in nature; all the subjects recovered, and only
1 (abdominal colic preceded by a flu) incident was possibly related to the
treatment.
The use of timolol in myopia has been linked to stinging sensations and
even bronchial asthma.
42
This may be one reason why the scientific
community has not pursued the use of ocular hypertensives in myopia.
The Future of Drug Treatment in Myopia
The mechanism of atropine in retarding the progression of myopia is not
clearly understood. The original rationale for using atropine in myopia
was the paralysis of accommodation to achieve slowing of myopia
progression. However, atropine can still be effective in animal models
following destruction of mid-brain nuclei and paralysis of accommoda-
tion.
48
There are possible alternative mechanisms or multiple mechanisms,
such as the remodeling of scleral connective tissue via a retinal or scleral
mechanism.
Although atropine and pirenzepine are known muscarinic antagonists
and these receptors are present in the eye, including the sclera, it is not
known if the anti-myopia effects of these drugs are mediated principally
by muscarinic receptors. Even if muscarinic receptors mediate the benefi-
cial effect observed clinically, it is still unclear what subtype of muscarinic
receptor or what signaling events are critical for the effect.
The future of drug treatment in myopia will be influenced by further
development in the understanding of the basis of myopia development as
well as the pharmacology, and cell and molecular biology of myopiagene-
sis. With the increased understanding of these areas, more targeted, safer
and more effective treatment can be developed. An attractive idea is the
customization of pharmacological treatment to different individuals.
Since there is a genetic component to myopia development, there may also
be differences in response to drug treatment. Such difference may be
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 355
uncovered, for example, by genetic testing of single nucleotide polymor-
phisms. In addition, pharmacological treatment may be complementary
to other behavioral treatment such as lifestyle modification or increase of
outdoor activities.
What is the aim of pharmacological treatment in myopia? Most clinical
trials in myopia currently evaluate the progression of myopia. This is a
logical approach because the sight-threatening complications of myopia
such as macular degeneration and retinal breaks increase tremendously
with high myopia. If myopia can be arrested at an earlier stage, it may
become a purely optical problem that is amenable to glasses or refractive
surgical procedures. With increased understanding of myopia pathogenesis,
it may be possible to shift the aim of treatment to the prevention of the
onset of myopia. This type of preventive treatment, for example, may be
employed in susceptible children with a family history of high myopia and
other risk factors.
Conclusions
Myopia is a common ocular condition affecting many people, and recently
attention has focused on the high prevalence and incidence of childhood
myopia. Pharmacological treatment of myopia involves the use of various
types of eyedrops but clinically, the most effective form of treatment is the
use of atropine eyedrops. The aim of treatment with atropine eye drops is
to retard the progression of myopia. Although this form of treatment can
be judiciously used in suitable children, the optimal regime of administra-
tion of atropine eyedrops remains to be shown.
References
1. Goss DA. (1982) Attempts to reduce the rate of increase of myopia in young
people — A critical literature review. Am J Optom Physiol Opt 59(10): 828–841.
2. Curtin BJ. (1985) The etiology of myopia. The myopias. Basic science and clin-
ical management. Philadelphia: Harper and Row.
3. Saw SM, et al. (2000) Myopia: attempts to arrest progression. Br J Ophthalmol
86(11): 1306–1311.
4. Saw SM, et al. (2002) Interventions to retard myopia progression in children:
an evidence-based update. Ophthalmology 109(3): 415–421.
356 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 356
357 Atropine and Other Pharmacological Approaches to Prevent Myopia
5. Horner DG, et al. (1999) Myopia progression in adolescent wearers of soft
contact lenses and spectacles. Optom Vis Sci 76(7): 474–479.
6. Ong E, et al. (1999) Effects of spectacle intervention on the progression of
myopia in children. Optom Vis Sci 76(6): 363–369.
7. Katz J, et al. (2003) A randomized trial of rigid gas permeable contact lenses
to reduce progression of children’s myopia. Am J Ophthalmol 136(1): 82–90.
8. Khoo CY, Chong J, Rajan U. (1999) A 3-year study on the effect of RGP
contact lenses on myopic children. Singapore Med J 40(4): 230–237.
9. Polse KA, et al. (1983) Corneal change accompanying orthokeratology. Plastic
or elastic? Results of a randomized controlled clinical trial. Arch Ophthalmol
101(12): 1873–1878.
10. Angi MR, et al. (1996) Changes in myopia, visual acuity, and psychological
distress after biofeedback visual training. Optom Vis Sci 73(1): 35–42.
11. Yang Z, et al. (2009) The effectiveness of progressive addition lenses on the
progression of myopia in Chinese children. Ophthalmic Physiol Opt 29(1):
41–48.
12. Hasebe S, et al. (2008) Effect of progressive addition lenses on myopia
progression in Japanese children: a prospective, randomized, double-masked,
crossover trial. Invest Ophthalmol Vis Sci 49(7): 2781–2789.
13. Bedrossian RH. (1979) The effect of atropine on myopia. Ophthalmology
86(5): 713–719.
14. Tan DT, et al. (2005) One-year multicenter, double-masked, placebo-
controlled, parallel safety and efficacy study of 2% pirenzepine ophthalmic
gel in children with myopia. Ophthalmology 112(1): 84–91.
15. Manny RE, et al. (2001) Tropicamide (1%): an effective cycloplegic agent for
myopic children. Invest Ophthalmol Vis Sci 42(8): 1728–1735.
16. Yen MY, et al. (1989) Comparison of the effect of atropine and cyclopentolate
on myopia. Ann Ophthalmol 21(5): 180–182, 187.
17. Quinn GE, et al. (1995) Association of intraocular pressure and myopia in
children. Ophthalmology 102(2): 180–185.
18. Wiener M. (1931) The use of epinephrin in progressive myopia. Am J
Ophthalmol 14: 520–522.
19. Chua WH, et al. (2006) Atropine for the treatment of childhood myopia.
Ophthalmology 113(12): 2285–2291.
20. Tong L, et al. (2009) Atropine for the treatment of childhood myopia: effect
on myopia progression after cessation of atropine. Ophthalmology 116(3):
572–579.
21. Barathi VA, Weon SR, Beuerman RW. (2009) Expression of muscarinic recep-
tors in human and mouse sclera and their role in the regulation of scleral
fibroblasts proliferation. Mol Vis 15: 1277–1293.
22. Liu S, et al. (2007) The eyelid margin: a transitional zone for 2 epithelial
phenotypes. Arch Ophthalmol 125(4): 523–532.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 357
358 L.M.G. Tong, V.A. Barathi and R.W. Beuerman
23. McBrien NA, Gentle A. (2001) The role of visual information in the control
of scleral matrix biology in myopia. Curr Eye Res 23(5): 313–319.
24. Wessler I, Kirkpatrick CJ. (2008) Acetylcholine beyond neurons: the
non-neuronal cholinergic system in humans. Br J Pharmacol 154(8):
1558–1571.
25. Borda E, et al. (2005) Correlations between neuronal nitric oxide synthase
and muscarinic M3/M1 receptors in the rat retina. Exp Eye Res 80(3):
391–399.
26. Collison DJ, et al. (2000) Characterization of muscarinic receptors in human
lens cells by pharmacologic and molecular techniques. Invest Ophthalmol Vis
Sci 41(9): 2633–2641.
27. Narayan S, et al. (2003) Endothelin-1 synthesis and secretion in human
retinal pigment epithelial cells (ARPE-19): differential regulation by choliner-
gics and TNF-alpha. Invest Ophthalmol Vis Sci 44(11): 4885–4894.
28. Yin GC, Gentle A, McBrien NA. (2004) Muscarinic antagonist control of
myopia: a molecular search for the M1 receptor in chick. Mol Vis 10: 787–793.
29. Bitzer M, et al. (2006) Effects of muscarinic antagonists on ZENK expression
in the chicken retina. Exp Eye Res 82(3): 379–388.
30. Wessler I, Kirkpatrick CJ, Racke K. (1998) Non-neuronal acetylcholine, a
locally acting molecule, widely distributed in biological systems: expression
and function in humans. Pharmacol Ther 77(1): 59–79.
31. Gil DW, et al. (1997) Muscarinic receptor subtypes in human iris-ciliary body
measured by immunoprecipitation. Invest Ophthalmol Vis Sci 38(7): 1434–1442.
32. Savinainen JR, Laitinen JT. (2004) Detection of cannabinoid CB1, adenosine
A1, muscarinic acetylcholine, and GABA(B) receptor-dependent G protein
activity in transducin-deactivated membranes and autoradiography sections
of rat retina. Cell Mol Neurobiol 24(2): 243–256.
33. Qu J, et al. (2006) The presence of m1 to m5 receptors in human sclera: evi-
dence of the sclera as a potential site of action for muscarinic receptor antag-
onists. Curr Eye Res 31(7–8): 587–597.
34. McBrien NA, et al. (2009) Expression of muscarinic receptor subtypes in tree
shrew ocular tissues and their regulation during the development of myopia.
Mol Vis 15: 464–475.
35. Liu Q, et al. (2007) Changes in muscarinic acetylcholine receptor expression
in form deprivation myopia in guinea pigs. Mol Vis 13: 1234–1244.
36. Schwahn HN, Kaymak H, Schaeffel F. (2000) Effects of atropine on refractive
development, dopamine release, and slow retinal potentials in the chick. Vis
Neurosci 17(2): 165–176.
37. Taylor BJ, Smith PJ, Brook CG. (1985) Inhibition of physiological growth
hormone secretion by atropine. Clin Endocrinol (Oxf) 22(4): 497–501.
38. Shih YF, et al. (1999) Effects of different concentrations of atropine on
controlling myopia in myopic children. J Ocul Pharmacol Ther 15(1): 85–90.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 358
359 Atropine and Other Pharmacological Approaches to Prevent Myopia
39. Schwartz JT. (1981) Results of a monozygotic cotwin control study on a
treatment for myopia. Prog Clin Biol Res 69: 249–258.
40. Sampson WG. (1979) Role of cycloplegia in the management of functional
myopia. Ophthalmology 86(5): 695–697.
41. Chou AC, et al. (1997) The effectiveness of 0.5% atropine in controlling high
myopia in children. J Ocul Pharmacol Ther 13(1): 61–67.
42. Jensen H. (1991) Myopia progression in young school children. A prospective
study of myopia progression and the effect of a trial with bifocal lenses and
beta blocker eye drops. Acta Ophthalmol Suppl 200: 1–79.
43. Shih YF, et al. (2001) An intervention trial on efficacy of atropine and multi-
focal glasses in controlling myopic progression. Acta Ophthalmol Scand 79(3):
233–236.
44. Liu H, et al. (1994) Treatment of adolescent myopia by pressure plaster of
semen impatientis on otoacupoints. J Tradit Chin Med 14(4): 283–286.
45. Lucas JL, DeYoung JA, Sadee W. (2001) Single nucleotide polymorphisms of
the human M1 muscarinic acetylcholine receptor gene. AAPS PharmSci 3(4):
E31.
46. Boulesteix AL, et al. (2007) Multiple testing for SNP–SNP interactions. Stat
Appl Genet Mol Biol 6: Article37.
47. Luu CD, et al. (2005) Multifocal electroretinogram in children on atropine
treatment for myopia. Br J Ophthalmol 89(2): 151–153.
48. McBrien NA, Moghaddam HO, Reeder AP. (1993) Atropine reduces experi-
mental myopia and eye enlargement via a nonaccommodative mechanism.
Invest Ophthalmol Vis Sci 34(1): 205–215.
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 359
b846_Chapter-5.1.qxd 4/8/2010 2:03 AM Page 360
This page intentionally left blank This page intentionally left blank
Physical Factors in Myopia and
Potential Therapies
Wallace S. Foulds*
,†
and Chi D. Luu

Introduction
As is obvious from other contributions to this book, factors leading to the
development of myopia in childhood are thought to include both genetic
predisposition and environmental factors.
Although it has been held that after birth the expression of the genetic
program involved in refractive development may be fine-tuned by envi-
ronmental factors acting through the visual system,
1
the interplay between
genetic factors and environmental factors remains unknown.
2
Among possible environmental factors contributing to the etiology of
childhood myopia are a number of physical factors, some well recognised
and others not. Among these are factors contributing to the sharpness or
lack of sharpness of the retinal image that include the vergence of incident
light upon the eye, the curvatures and refractive indices of the transparent
media in the eye that are involved in the formation of the retinal image
and the nature of the incident light itself including its homogeneity,
contrast, spatial and temporal frequency characteristics and its spectral
composition.
The physical characteristics of the eye in terms of axial length, vitreous
chamber length, corneal and lens curvatures and their refractive indices
are obvious contributors to the formation of an in-focus retinal image as
is the degree of accommodation being exercised. Intraocular pressure
(IOP) might be a factor involved in the ocular expansion that underlies
axial myopia but raised IOP is not found in lid fused eyes developing
myopia,
1
and pressure lowering treatment with eye drops such as timolol
361
5.2
*Corresponding author. E-mail: [email protected]

Singapore Eye Research Institute, Singapore.
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 361
has failed to influence myopia progression.
4
Even the temperature of the
eye has been invoked as a possible aetiological factor in the development
of experimental myopia.
4
As regards therapy, correction of myopia by spectacles, contact lenses
or various forms of refractive surgery that include corneal reshaping proce-
dures, clear lens extraction, insertion of piggyback lenses and (mainly in
the past) scleral shortening procedures may correct the optical consequences
of myopia but these do not address the underlying condition of the eye.
Pharmacological treatments such as atropine eye drops can beneficially
influence the abnormal growth of the eye that occurs in myopia, but as
abnormal growth of the eye is probably a consequence of altered retinal
cell signalling in response to an abnormal retinal image, such treatment,
although effective to a degree, addresses the result rather than the cause of
the condition.
Genetic factors that appear to play a role in the predisposition to
myopia are almost certainly polygenic rather than monogenic, thus
restricting the possible application of genetic engineering. Genetic manip-
ulation is also limited due to an incomplete knowledge of the genes
involved in the genesis of myopia. Manipulation of retinal cell signaling is
also restricted by an inadequate understanding of the retinal factors
involved in the etiology of myopia. It has been stated that the identifica-
tion of myopia susceptibility genes could provide an insight into the
molecular basis of myopia and could lead to therapies to prevent the
development of myopia or to slow its progression but to date such infor-
mation remains elusive.
6
As physical factors affecting the visual image appear to play a crucial
role in the etiology of myopia, modification of these factors holds promise
of future therapies but again this would be dependent upon a better
understanding of the role of the various physical factors involved in the
genesis of myopia. In this chapter, we explore the known roles of some of
these factors and suggest hypotheses to explain others.
In 1990, Wallmann
6
asked, “What visual stimuli or lack of what visual
stimuli provoke myopia?” and although much more is known about the
factors involved in the genesis of myopia we are still not in a position to
answer Wallman’s question with any confidence.
Accommodation
In the early 20th century, it was accepted that excessive close work was
the main environmental factor involved in the etiology of myopia and as
362 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 362
close work demanded extended periods of accommodation, it was
believed that excessive accommodation was the major contributor not
only to the development of myopia but also its progression.
Sight-saving schools, involving large print and distance learning rather
than close work, were established in the belief that avoidance of prolonged
accommodation would prevent or slow childhood myopia. In the event
sight-saving schools were a great disappointment for no benefit was found
and before long these schools were closed down.
There are many reasons why excessive accommodation is unlikely to
play a direct role in the etiology of childhood myopia although, as has pre-
viously been suggested, the stimulus to accommodation from a blurred
retinal image may be the same stimulus that leads to axial ocular growth
and myopia.
6
Accommodation undergoes constant short-term fluctuations in
response to variations in the proximity of objects in the field of view,
whereas if the same factors that stimulate accommodation are also those
involved in eye growth, in the latter instance, they must act over a much
more prolonged time-span. A greater than average degree of retinal
image blur over time could be a factor influencing eye growth, carrying
with it a greater than average degree of accommodation. Thus, a variably
blurred retinal image could result in the short-term stimulation of
accommodation and in the longer term an alteration in ocular growth,
both being a consequence of excessive retinal image blur but without
accommodation in itself having a direct effect on ocular growth or
refractive development.
Evidence that excessive accommodation does not cause myopia
includes the fact that visual deprivation myopia can be induced in the
young of many animal species, including primates, when accommoda-
tion has been abolished by destruction of the ciliary ganglion or the
Edinger–Westphal nucleus in the brain stem or following optic nerve
section.
7
Recovery from refractive errors induced by the wearing of
minus or plus lenses can also occur after accommodation has been
surgically abolished.
8
Experimentally astigmatic errors of refraction can be induced in chicks
by the wearing of cylindrical lenses, an outcome that cannot be related to
accommodation.
9
It has also been found that steps taken to reduce
accommodative effort such as the use of bifocal glasses have had no
demonstrable beneficial effect on the progress of childhood myopia.
10
The
administration of 1% atropine eye drops has been shown to slow the
progress of childhood myopia,
11–13
and may be effective even in reduced
363 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 363
concentration,
14
but the assumption that atropine acts via paralysis of
accommodation is too simplistic.
Atropine is a non-specific muscarinic antagonist that has many func-
tions within the eye. There are muscarinic receptors of various types in
many ocular tissues, including the retina
15
and the sclera,
16
in addition to
their presence in mammalian ciliary muscle. Atropine has been shown to
have an inhibitory effect on scleral fibroblasts,
17
preventing their prolifer-
ation and reducing their production of collagen, and this may explain the
effect of atropine on reducing progressive scleral elongation associated
with myopia.
Although atropine eye drops can prevent the development of experi-
mental myopia in chicks,
18
in this species atropine has no effect on accom-
modation for the ciliary muscle in chicks is striated muscle, and does not
contain the M1 muscarinic receptor
19,20
i.e. the receptor most closely related
to myopia.
21
In mammalian species, the ciliary muscle is non-striated and
the ciliary body in mammals, e.g. the tree shrew, demonstrates the presence
of all five types of muscarinic receptor, including the M1 receptor.
22
Close work
Studies investigating the effect of close work in relation to the risk of child-
hood myopia have produced conflicting results. In some studies, there is a
clear correlation between the amount of close work and the risk and sever-
ity of myopia development,
23,24
while in other studies, the association is
absent.
25,26
Recently, it has been shown that rather than close work being
an etiological factor for myopia, lack of outdoor activity may be the key,
for outdoor activity is protective.
27–29
Outdoor activity appears to be pro-
tective against myopia in its own right and not just as a reciprocal of
indoor activity.
30
Physical characteristics of the retinal image
Visual deprivation
As is well known, visual deprivation in early life leads to the development
of myopia in many species including humans. Although the elongation of
the eye leading to axial myopia appears to be driven by a retinal response
to the physical characteristics of a blurred retinal image, the specific
physical characteristics of a blurred image causing myopia remain to be
identified.
364 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 364
Compensatory changes in refraction
In relation to experimental myopia it has been shown that young animals
wearing negative lenses become myopic while those wearing positive
lenses become hyperopic
9,31
and this includes primates.
32
It appears that
the retina is able to differentiate between hyperopic blur and myopic blur
even when the optic nerve has been sectioned.
33
The ability of the retina to
detect the sign of a defocused image allows a compensatory change in
refraction to occur as a result of an alteration of eye growth in the appro-
priate direction but at present there is no satisfactory explanation for this.
The differing vergences of light in conditions of hyperopic or myopic
defocus have been suggested as providing cues for the identification of the
sign of defocus in these two conditions.
34
Longitudinal chromatic aberration has also been suggested as allowing
the eye to differentiate between hyperopic and myopic defocus.
35–38
The
characteristics of the retinal blur circle induced by defocus has also been
advanced as an explanation for the ability of the retina to determine the
sign of defocus
39
but this has been disputed.
40
Intensity and periodicity of light exposure
Light intensity and photoperiod are physical factors that appear to affect
ocular and refractive development in a very complex fashion. As regards
photoperiod, rearing chicks in continuous illumination leads to severe
hyperopia, raised intraocular pressure, reduction of corneal curvature and
of anterior chamber depth with an increase in axial and vitreous chamber
lengths.
41,42
The hyperopia that develops results from flattening of the
cornea that overcomes the effect of increased length of the eye that would
otherwise cause myopia. Continuous illumination also prevents visual dep-
rivation myopia in the chick but not the compensatory myopia induced by
negative lenses.
43
In experimental animals it has been shown that the intensity of light in
which animals are reared can have a significant effect upon ocular and
refractive development. The effect of continuous illumination on the chick
eye appears to be intensity dependent.
44
Chicks exposed to higher intensi-
ties of light have longer vitreous chamber lengths but flatter corneas and
are hyperopic. Chicks raised in low light conditions are less hyperopic than
those raised in bright light.
45
This situation of continuous illumination,
however, is so abnormal that it has no obvious corollary with human
refractive development.
365 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 365
Spatial frequency
One possible feature of a blurred image as compared with a sharp image
is a difference in spatial frequency composition. Judge (1990),
46
however,
was of the opinion that eye growth was unlikely to be influenced by the
spatial frequency content of the retinal image as even slight defocus would
eliminate all high frequency information. Additionally, it has been noted
that young monkeys do not develop a high resolution visual system until
around two years of age,
47
so would be unaffected by high frequency spa-
tial information in the visual image (or its absence) at the young age when
visual deprivation myopia can be induced.
Lenses inducing myopia in chicks are those that block the transmission
of mid- and high frequencies
48
and it has been concluded that
emmetropization is tuned to mid-frequency spatial frequencies.
41
In
another study in chicks, it was also concluded that mid-spatial frequency
tuning was necessary for emmetropization although chromatic aberration
might have a role as a clue to defocus.
49
In some experiments no significant interaction between the spatial fre-
quency characteristics and sign of defocus was demonstrated.
38
Others
have reported that the inclusion of mid to high spatial frequencies is
necessary for refractive compensation to induced defocus.
50
It has been suggested that it is not the edge structure of the spatial fre-
quency alignments within the image but the spatial frequency composi-
tion itself that controls eye growth
51
and the relative energy distribution
across spatial distributions that is important. Because reduced luminance
shifts contrast sensitivity to lower spatial frequencies, it has been suggested
that reduced luminance acting through a reduction in spatial frequency,
content of the retinal image may be a factor inducing a myopic shift in
refraction.
52
Contrast adaptation that is a spatial frequency dependent increase in
contrast sensitivity after exposure to low contrast patterns may be another
mechanism involved in refractive development for contrast adaptation
correlates with various optical manipulations inducing myopia (frosted
lenses, negative lens wear, and decreased retinal image sharpness).
53
Light periodicity
Temporal modulation of light intensity using flickering light of low fre-
quency (1–4 Hz) with luminance levels varying between 1.5 and 180 lux,
366 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 366
during 12 hours of diurnal light exposure, had a marked myopia inducing
effect on chicks wearing negative or positive lenses but not those with no
defocus. The effect was greater in conditions of hyperopic blur than
myopic blur.
54
It is known that a flickering light of low frequency causes
marked retinal vasodilatation
55
thought to be due to nitric oxide release.
56
Although a reduced release of dopamine occurs in visual deprivation
myopia and in the myopia occurring in low light rearing conditions, in
another study,
57
flicker at a variety of frequencies from 2–20 Hz did not
affect dopamine release from dopaminergic amacrine cells in the chick
retina, suggesting that the cells in the retina thought to be involved in
myopigenic signalling do not respond readily to short-term changes in
retinal illumination.
In chicks, compensation to wearing plus or minus 10 D lenses was also
affected by temporal and spatial characteristics of the retinal image. With
temporal modulation having either a fast-on or a fast-off luminance gra-
dient, compensation to +10 D lenses was reduced by a fast-on modula-
tion and compensation to −10 D lenses similarly reduced by a fast-off
modulation.
58
Image clarity
In an attempt to see whether there were significant optical differences
between out of focus images caused by negative lenses as compared with
positive lenses, we carried out a series of experiments. Black and white
checkerboard patterns were photographed in-focus and with varying
degrees of defocus induced by negative or positive lenses placed in front of
the camera lens. Not unexpectedly defocus reduced contrast, induced
chromatic dispersion and had a significant effect on spatial frequency. The
square-wave pattern of an in-focus checkerboard image was converted to
a sign-wave pattern by 2–3 dioptres of defocus. All of these features of
defocused images, however, were similar in degree whether the defocus
simulated myopic or hyperopic blur and none offered an acceptable expla-
nation for the apparent ability of the retina to differentiate between hyper-
opic and myopic blur, i.e. the sign of the defocus.
Another optical factor that might be a possible contributor to the
etiology of myopia is the proportion of in-focus and out of focus infor-
mation present in the visual image. It has been tacitly accepted that as a
blurred retinal image in early life causes myopia, a sharp retinal image is
required for emmetropia. In everyday life, however, a totally sharp image
367 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 367
is as abnormal as a totally blurred image for a normal image contains an
admixture of in-focus and out of focus content in varying proportions,
according to the degree of accommodation exercised and the number and
size of near and distant objects within the field of view.
It has been shown,
59
that even in adults, prolonged microscopy using
infinity focus binocular microscopes is associated with an increased preva-
lence of myopia, some 39% of initially emmetropic adult microscopists
becoming significantly myopic after two years of intensive microscopy,
and a larger proportion (48%) of initially myopic adult microscopists
becoming significantly more myopic over the same time span. The myopia
in both instances was axial myopia with a significant increase in axial and
vitreous chamber lengths in those affected.
As a focused image viewed through a microscope is totally in-focus
across the whole visible field of view, there is at least a possibility that this
very abnormal situation might contribute to the reported development of
myopia in microscopists undertaking intensive microscopy. In a study in
chicks undergoing optical defocus and either preclusion of sharp vision or
limited sharp vision, it was found that limited sharp vision was required to
compensate for induced myopia.
60
During reading with the eyes accommodated at reading distance, a large
area of the visual field will be occupied by a uniformly in-focus image, so
reproducing to an extent the visual situation experienced by microscopists
where the visual field through a microscope is also completely in-focus.
It has been shown in chicks with lens induced myopia the viewing of a
near target confocal with the retina but on a transparent background so
allowing more distant visual information to contribute to the retinal
image, that the myopia was reduced or eliminated, but only if accommo-
dation were intact.
34
In this situation, with the eye accommodated to the
distance of the near target, additional distance visual information would
add a proportion of myopic blur to the retinal image. As myopic blur is
known to be protective against myopia, the presence of a proportion of
myopic blur in the image appears to have been sufficient to overcome the
degree of myopia that had previously been induced in these chicks by
negative lens wear.
Outdoor activity and retinal image blur
In general, during outdoor activity, objects on the horizon are of less inter-
est than objects nearer at hand and if visual activity is largely restricted to
368 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 368
near and mid-distance objects, images from more distant objects will be
focused in front of the retina so producing myopic blur that is known to
act against the development of myopia in experimental animals. This is an
everyday corollary to the experimental work in chicks that included both
in-focus near targets and distance information.
34
The situation is quite dif-
ferent in close work where images of objects from a distance are largely
prevented from reaching the eye, being obscured by the reading material
that will occupy a significant proportion of the visual field. In addition to
the elimination of the protective myopic blur from distant objects, reading
material being in-focus across a significant proportion of the visual field
will reduce the out of focus content of the visual image. Currently, how-
ever, there is no experimental work assessing whether a totally in-focus
image on its own can induce changes in eye growth.
Light vergence and photon catch
In relation to the ability of the retina to differentiate between myopic and
hyperopic blur, as has already been noted, an obvious difference between
these two situations is that in hyperopic defocus, light passing through the
retina to come to a focus behind it is convergent, whereas in myopic defo-
cus with images of distant objects focused in front of the retina, light pass-
ing through the retina is divergent. In considering how the retina might be
able to differentiate between the blurred images caused by convergent or
divergent light, the effect of these two optical conditions on the distribu-
tion of photons along the lengths of the photoreceptor outer segments
appears to offer a possible explanation.
In conditions of convergent light, photons will become more closely
packed as the convergent light nears its point of focus posterior to the
photoreceptor outer segments so that in the case of hyperopic blur, as con-
vergent light passes through the retina, photon density and absorption in
the photoreceptors will increase towards the tips of the photoreceptor
outer segments and decrease in their more proximal bases.
Conversely in conditions of myopic blur with focus in front of the
retina and divergent light passing through the retina, photon density will
decrease along the length of the photoreceptor outer segments so that
there will be an increased photon catch at the bases of the photoreceptor
outer segments rather than the tips.
It may be asked whether the Stiles Crawford effect,
61
in which pho-
tons are thought preferentially to enter the proximate ends of the outer
369 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 369
segments and be transmitted axially in the outer segments as a result of
their waveguide properties, would prevent any skewed distribution of
photons within the receptor outer segments. There is good evidence, how-
ever, that photons can be transmitted transversely through the lateral
outer segment membrane and induce depolarisation limited to a very
localised section of the outer segment.
62
In conditions of myopic or hyperopic defocus with an enlarged blur
circle in the retina for either condition, very few photons would be travel-
ling in a path normal to the plane of the retina, and as a result, very few
would be admitted to the receptor outer segments if only those arriving
normal to the inner surface of the outer segment were able to enter the
outer segment.
Defocus does reduce contrast sensitivity for spatial frequencies in the
range 3–38 cycles/degree but not lower frequencies.
63
Defocus, however,
does not reduce total retinal illuminance. In personal experiments in
which there was rapid alternation of viewing an illuminated target with a
focused or a defocused eye, it was noted that optical defocus with plus or
minus lenses up to ± 10 D had no effect on the perceived brightness of the
illuminated target, thus indicating that photons arriving at the retina
along convergent or divergent paths were captured by the outer segments.
Thus it would be possible, that the differing vergences of light reaching the
retina in hyperopic or myopic defocus could be identified in the retina as
a result of a skewed distribution of photon catch along the photoreceptor
outer segments.
Where there was an increased photon catch in the tips of the outer
segments, such would occur in hyperopic defocus; elongation of the eye
would act to even out the distribution of photon catch along the outer seg-
ments by moving the maximal photon absorption towards the mid-points
of the photoreceptor outer segments.
In visual deprivation myopia in chicks, there is an elongation of the
photoreceptor outer segments that has been suggested as a driving force
for ocular elongation.
64
In the short-term, a skewed distribution of photon
catch along the photoreceptor outer segments might be a stimulus to
accommodation and in the longer term to eye growth.
Thus, it is possible that the young eye may be programmed to elongate
in response to hyperopic blur in an attempt to overcome an unequal dis-
tribution of photons along the length of photoreceptor outer segments.
Conversely, an increased photon catch at the bases of the photoreceptor
outer segments in conditions of myopic blur would inhibit ocular axial
370 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 370
growth and if growth characteristics of the lens or cornea were unaffected,
this might account for the development of hyperopia in experimental
animals in which myopic blur has been induced by the wearing of positive
lenses. It is known that the response to an alteration in the vergence of light
reaching the eye is almost immediate
65
as would be expected if the compen-
satory response to positive or negative lens wear were a function of photon
distribution in the receptor outer segments. In the short-term a skewed
distribution of photon catch along the photoreceptor outer segments might
be a stimulus to accommodation and in the longer term to eye growth.
Chromaticity
The effects of longitudinal and transverse chromatic aberration on the
focus and location of the retinal image are well known, longitudinal chro-
matic aberration forming the basis of the duochrome test, red light being
focused in the eye more posteriorly than green or blue light. The retinal
effect of chromatic aberration may also be increased by dispersion of
shorter wavelengths by the lens.
66
In white light where all the colors of the spectrum are present in an
image, some of the red wavelengths will be focused behind the photore-
ceptor layer of the retina, while some of the shorter wavelength blue light
will be focused in front of the photoreceptor layer of the retina, a situation
that has been identified as a factor involved in the elongation of the eye in
the development of myopia.
38
In the human eye, there are three types of cones: L-cones that prefer-
entially absorb long wavelength red photons; M-cones absorbing maxi-
mally mid-wavelength photons; and S-cones preferentially absorbing
short wavelength blue photons. In the chick, there are five colour sensi-
tive cone types and a double cone responding to movement
67
but the
spectral sensitivity curve of the chick eye is similar to that of the
human.
68
L-cones and M-cones greatly outnumber S-cones but this may be a
reflection of the fact that blue photons are significantly more energetic
than green or red photons, so likely to stimulate a photochemical effect
in the photoreceptor outer segments in excess of their numbers, the
energy of a photon acting as a wave, being proportional to its frequency
and its momentum being inversely proportional to its wavelength.
As the human (and chick) eye is most sensitive to mid-wavelength
yellow/green light in photopic conditions, the probability is that
371 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 371
accommodation is largely influenced by these wavelengths. If green light
absorbed in the M-cones determines accommodation so as to maximize
luminance contrast, this would ensure that green wavelengths were
focused in the mid-points of the M-cone photoreceptor outer segments
and, additionally, that most of the red and blue wavelengths would be
accommodated within the lengths of the outer segments so that the whole
visible spectrum, with the exception of the longest red wavelengths or the
shortest blue wavelengths, could be accomodated within the length of the
outer segments with red light absorbed in the tips of L-cones, blue light
absorbed in the bases of S-cones and green light in the mid-points of M-
cones. In conditions of white light with all the wavelengths of the visible
spectrum present, if accommodation were largely determined by M-cones
and green light to which the retina is the most sensitive, there would be an
equal distribution of photon catch of red photons in the distal tips and of
blue photons in the proximal bases of the outer segments (or perhaps an
equal photochemical effect allowing for the increased energy of short
wavelength photons as compared with longer wavelengths and the
reduced number of S-cones).
In spite of the fact that there is good evidence that the degree of accom-
modative effort is unlikely to be directly involved in the etiology of
myopia, a number of studies have used assessments of accommodation in
relation to chromatic aberration as an indication of myopia risk.
It has been shown that the accommodation response is sensitive to the
chromatic properties of the stimulus, the degree of accommodation being
determined by the relative sensitivities of L- and M-cones.
36
It has been
suggested that if luminance contrast is maximized by accommodation, the
longest red wavelengths will be focused behind the photoreceptor layer of
the retina and the shortest blue wavelengths infront ot it. It has also been
suggested that in individuals in whom luminance contrast is dominated by
L-cones, this would result in increased accommodation, elongation of the
eye and myopia.
36
It has also been shown that the use of green paper
(absorbing longer wavelengths) during reading reduces accommodative
effort and may thus protect against myopia.
69
In another study
35
it was shown that humans and chicks accommodated
more in red light and less in blue light in accordance with chromatic aber-
ration and that in chicks, a small compensatory change in refractive error
could be demonstrated when chicks were refracted in total darkness but
not in white light unless refracted under cycloplegia. The difference
between the results of this study and an earlier study,
68
where no change in
372 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 372
accommodative tonus or of refraction was found in chicks raised in red or
blue near monochromatic light, was ascribed to the fact that the wave-
lengths of blue light used in the later study were longer than those used in
the earlier study.
Longitudinal chromatic aberration in conditions of retinal blur leading
to visual deprivation myopia, has been held to provide complex color-coded
cues for reflexive accommodation.
62
As these chromatic cues are most sen-
sitive to spatial frequencies between 3 and 5 cycles/degree, it has been sug-
gested as a possibility that a change in the spatial frequency composition
of the retinal image will reduce the sensitivity to chromatic cues, resulting
in inadequate accommodation leading to a hyperopic blur and myopia.
70
Although a number of features of the retinal image in lid closure such
as reduced luminance, reduced contrast, loss of higher frequency spatial
content, the effect of altered chromaticity has received little if any atten-
tion. In lid closure, the eyelid with its rich blood supply is effectively a red
filter. Additionally, as white light traverses the closed eyelids, shorter
wavelengths are more likely to be dispersed than are longer wavelengths.
An alteration in the spectral composition of light reaching the retina with
a preponderance of longer wavelength red light and a deficit of shorter
wavelength blue light would be an expected result.
Alterations in the spectral composition in which developing animals are
raised can lead to structural changes in the eye. Thus, blue acara fish raised
for two years in near monochromatic light of various wavelengths
71
showed a marked increase in the length of the photoreceptor outer seg-
ments of L-cones and M-cones when raised in shorter wavelength blue
light. This was ascribed to a compensatory response to long and medium
wavelength deprivation. It had previously been shown that fish reared in
light of longer wavelengths had increased ocular nasotemporal diameters
as compared with those raised in shorter wavelength light.
72
In the enhanced S-cone syndrome,
73
it is believed that there is an actual
increase in the number of S cones in the retina and that these replace some
of the L- and M-cones.
74
In this condition, the affected eyes are usually
hyperopic as would be expected with a greater photon catch in the bases
of the increased number of S-cone photoreceptor outer segments as com-
pared with photon catch in the tips of the photoreceptor outer segments
of the reduced number of L-cones.
It is interesting that growth in other biological systems can be influ-
enced by the spectral composition of incident light, for in experiments
related to the production of food plants for space exploration, it was
373 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 373
found that although plants (lettuces) could be grown in red and blue
light, or in white light, their growth was greatly enhanced beyond that in
white light by the addition of 24% green light to red and blue growing
conditions.
75
A possible explanation for the effects that chromaticity might have on
ocular or refractive development would be a differential stimulation of red
or blue sensitive cones. This explanation however is rendered highly
unlikely as in experiments in which chicks were raised in narrow band
near monochromatic red light or narrow band near UV blue light,
68
ocu-
lar and refractive development was similar in each of the two chromatic
conditions. In these experiments, only very restricted red wavelengths of
650–700 nm or blue light of 350–425 nm were used and the probability is
that the chicks accommodated to whatever wavelengths were available so
that those raised in purely red light would accommodate to the degree
necessary to focus the available red light in the mid-points of the red sen-
sitive cone outer segments and, similarly, those raised in blue light would
accommodate to ensure the focus of blue light in the mid-points of the
blue sensitive cone outer segments. There would thus be no imbalance of
photon catch along the length of the outer segments, with most of
the photon catch being in the mid-points of the outer segments and very
little photon catch in either their tips or the bases.
To test whether an unequal distribution of photon catch along the pho-
toreceptor outer segments affects ocular growth and, therefore, refractive
development in the young animal, we investigated in chicks the effect of
chromatic manipulation designed to increase photon catch in the tips of
the outer segments or alternatively in their bases. This would also explain
the fact that chicks can emmetropise in monochromatic light.
In preliminary experiments carried out to test the hypothesis that ocu-
lar growth and refractive development might be influenced by the distri-
bution of photon catch along photoreceptor outer segments, we have raised
newborn chicks in lighting conditions that contained either an excess of
longer wavelength red light or of shorter wavelength blue light, together
with an adequate amount of mid-wavelength green light, to ensure that the
focal plane for mid-wavelength green light was focused in the outer seg-
ment mid-points. Where chicks were raised in lighting conditions contain-
ing red and green wavelengths but little blue, if accommodation were
determined by the green wavelengths, there would be a preponderance of
red photons in the tips of relevant photoreceptor outer segments with a
lack of balancing blue photons in the S-cone photoreceptor outer segment
374 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 374
bases. Where chicks were raised in combined blue and green light without
red wavelengths, the opposite would be the case.
Chicks were raised in a light-tight enclosure with a 12 hours on/12hour
off illumination cycle from banks of either red or blue emitting light emit-
ting diodes (LEDs). The emission spectrum of red emitting LEDs con-
tained wavelenghts between 575 nm and 700 nm with a peak emission at
640 nm. The emission spectrum of the blue emitting LEDs ranged between
430 nm and 550 nm with a peak emission at 490 nm. Luminance of red and
blue emitting LEDs was equal. The enclosure was lined with high contrast
black and white stripes, giving a range of spatial frequencies (depending on
location of chicks within the enclosure) of 4–8 cycles/degree.
Our initial results support the hypothesis that development of the young
eye is influenced by the distribution of photon catch along the photorecep-
tor outer segments, for those raised in light with a preponderance of longer
wavelength red light (with some green) were myopic (–1.50 D to –2. 50 D
at 14 days). In contrast those raised in light containing a preponderance
of shorter wavelength blue light (and some green) that were hyperopic
(+2.50D to +3.50 D at 14 days). There was a highly significant difference in
mean refraction between the two lighting conditions (p < 0.001) and a
significant difference in mean vitreous chamber lengths, that in the myopic
eyes of chicks raised in red plus green light were significantly longer than in
the hyperopic eyes of chicks raised in blue plus green light (p < 0.01).
As already indicated an alternative explanation for the effect of chro-
maticity upon refractive development could be that a preponderance
of red or blue light might produce an effect on ocular development by
altering the balance between stimulated L-cones and S-cones rather than
an imbalance of photon catch along the lengths of the outer segments.
The fact that raising chicks in either pure monochromatic red or pure
blue light (without the addition of any intermediate wavelenghts) has no
effect upon eye growth or refractive development
68
makes this explanation
unlikely.
When the spectral emission characteristics of artificial light (tungsten
lamps and the more recently introduced long-life fluorescent lamps) were
examined, both types of artificial lighting were found to have a prepon-
derance of red light in their emission spectra, a significant amount of mid-
wavelength green emission and very little blue emission that might explain
why indoor activity rather than close work is associated with the develop-
ment of myopia, for a large proportion of indoor activity will be
undertaken in conditions of artificial lighting.
375 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 375
In contrast, when the spectral characteristics of outdoor scenes were
analysed, they were found to contain a preponderance of shorter wave-
lengths of light in virtue of their predominately blue skies and green
foliage. The spectral composition of light experienced during outdoor
activity could be one explanation for the protective effect against myopia
reported in recent studies. A study comparing time spent in outdoor activ-
ity with time spent in artificial light rather than time spent in reading
might provide some interesting results.
We have investigated the spectral composition of outdoor scenes in var-
ious climatic conditions. In cloudy conditions, there is an equal amount of
red, green or blue in the average outdoor scene. Not unexpectedly, in sun-
set scenes there is a preponderance of red light while in the average sunlit
outdoor scene the largest contribution to spectral content is of blue wave-
lengths followed by a significant amount of green and a much reduced
contribution of red. Thus, the average daylight scene with a predominantly
blue sky and green foliage offers an additional explanation as to why out-
door activity appears to protect against the development of myopia. The
studies that identified the protective role of outdoor activity were carried
out in Ohio, USA,
26
Australia
25
and Singapore,
27
locations where blue skies
are the norm.
In a very large study of 3,636 school children aged between 6 and
18 years of age
76
it was found that those children whose homes were lit by
fluorescent lighting had an increased prevalence of hyperopia as com-
pared to those whose homes were lit by tungsten lighting. The older types
of fluorescent lights had a rather discontinuous emission spectrum with
strong emission peaks at 450 nm and 550 nm and a broad less intense
emission from 500 nm to 700 nm. The strong emission peaks at 450 nm
and 550 nm might account for the increased hyperopia that was associ-
ated with fluorescent lighting. More recent types of fluorescent lamps
have colour temperatures varying from 2700K to 6000K. Each has a dif-
ferent spectral emission depending on the phosphor coating. Those with
lower colour temperatures with an excess of longer wavelength emission
might be conducive to the development of myopia while those with a
high colour temperature with more blue in their emission spectrum
might be protective. In the absence of well designed trials the possible
effects of different types of fluorescent lighting on refractive development
remains speculative.
An interesting and as yet unexplained finding is that in more northerly
or southerly countries (but not in near equatorial countries) those born in
376 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 376
late summer months, when examined as adults, have a higher prevalence
of myopia than those born in the winter.
77,78
For the first few months of life, babies spend a large proportion of the
day asleep and it is only by three months of age or so that the eyes are
open for a large part of the day. Babies born in August (in northern coun-
tries) or in April (in southern latitudes) will be entering winter condi-
tions by the time their eyes are open for most of the day. In winter, with
a shortened period of daylight in non-tropical latitudes, babies of three
months plus of age will be exposed for a significant part of the day to arti-
ficial lighting with a preponderance of longer wavelengths that could pro-
vide a ready explanation for the finding of an increased prevalence of
myopia in those born in the summer but only in high and low latitudes
where short days occur in the winter. In equatorial or near equatorial
countries, the length of the day does not vary significantly with the sea-
son and this would explain the lack of any correlation between dates of
birth and refraction in such countries, for there would be no seasonal
variation in the amount of time throughout the year spent indoors or
outdoors.
As already indicated, during outdoor activity with accommodative
effort sufficient to achieve a sharp retinal image of near-to mid-distance
objects, the images of distant objects will be focused in front of the retina,
so inducing the myopic blur that appears to be protective against myopia.
Thus, both the chromaticity of the light reaching the retina as suggested by
others
79
and its vergence from distant objects when the eye is accommo-
dated for near-to mid-distance objects, are likely to play a role in the pro-
tective effect against myopia associated with outdoor activity.
If an increased photon catch in the tips of the photoreceptor outer seg-
ments as compared with their bases is a factor stimulating ocular elonga-
tion and myopia, it might be expected that those with protanopia or
protonomaly in whom there is an absent or reduced sensitivity to red light
might be more hyperopic (or less myopic) than the average person with
normal color vision. A recent extensive study in high school students
80
found a lower prevalence of myopia among students with red/green color
deficiency than among normal controls with a significant difference in
refractive error between the two groups. Additionally, those with
protanopia or protanomaly had shorter axial lengths than did color nor-
mal students, confirming that ocular growth and refractive development is
different among those with red/green color deficiency as compared with
those with normal colour vision. This finding is in keeping with the
377 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 377
hypothesis based on the distribution of photon catch along the length of
the photoreceptor outer segments.
If chromaticity of incident light is a factor influencing ocular and
refractive development, it could also be an explanation for the myopic shift
in refraction noted among adult microscopists, for hematoxylin and eosin
staining commonly used in stained sections has a large red content but
also a sufficient content of other wavelengths to ensure the focus of mid-
length wavelengths in the mid-points of M-cone photoreceptor outer
segments. With a preponderance of red wavelengths, there would be a
skewed distribution of photons in the outer segments in favor of the distal
portions of the L-cone outer segments that we hypothesise leads to axial
elongation of the eye and myopia.
Currently, although there is evidence that ocular and refractive devel-
opment can be influenced by a large number of physical attributes of the
light incident upon the eye, including intensity, spatial and temporal fre-
quency, contrast, photoperiodicity, vergence of incident light and chro-
maticity, the mechanisms underlying the development of myopia as a
result of these effects remain largely unexplained. There is a probability
that the influence of these various factors on ocular growth and refraction
is multifactorial just as the genetic contribution is thought to be polygenic.
In relation to chromaticity, we have proposed a hypothesis to explain
the role that photon distribution in the photoreceptor outer segments may
have in ocular development and the resulting refractive state. Even if the
hypothesis, as we believe to be the case, proves to be supportable, the
mechanisms by which an abnormal distribution of photons along
the outer segments of photoreceptors can influence ocular growth remain
to be elucidated.
Therapeutic implications
The physical factors that have been identified as playing a role in the devel-
opment of myopia are non-specific blurring of the retinal image, the inten-
sity of light reaching the eye and as yet undetermined factors related to
outdoor activity. The influence of spatial frequency of the light reaching
the retina and the periodicity of exposure is much less obvious. We advance
the hypothesis that ocular development in the young eye is governed by the
distribution of photon catch in the photoreceptor outer segments and
if this is the case, there are a number of strategies that might be considered
in terms of therapeutic intervention. The simplest therapeutic option is to
378 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 378
ensure that children are involved in as much outdoor activity as possible,
and additionally, that the amount of time spent in conditions of artificial
lighting is curtailed.
In the development of therapeutic interventions that might prevent the
onset of myopia or slow its progression, randomised trials of chromatic
manipulation of light incident on the eyes by appropriate modification of
school or home lighting, the wearing of spectacles with appropriate trans-
mission characteristics and so on, are not only required but are currently
underway.
The development of potential therapies would be greatly aided by a
better understanding of the biological and biochemical events that may
be induced by the hypothesised effect of an inappropriate photon catch
distribution in photoreceptor outer segments, and to this end, more
experimental work is necessary to elucidate the exact roles that specific
combinations of differing wavelengths of light may have on the retina.
Apart from modification of the chromaticity of light to which the
developing eye is exposed, it is theoretically possible to change the pattern
of photon catch in photoreceptor outer segments by optical means not
involving chromaticity. Thus, under-correction of myopia or the wearing
of plus lenses should advance the focal plane of light entering the eye but
decrease the vergence of light passing through the retina. This, in turn,
should favor an increased photon catch in the proximal ends of the pho-
toreceptor outer segments as compared with the distal ends.
The effect of under-correction of myopia or the wearing of plus lenses,
however, is likely to be much less effective than appropriate chromatic
manipulation. In conditions of white light (daylight) viewing, a propor-
tion of longer wavelength red light will be focused not in the photorecep-
tor outer segments but behind the retina. As a result under-correction of
myopia or the use of low power plus lenses will not affect the relative pho-
ton catch in the tips and bases of the outer segments, unless the lenses were
strong enough to move the focal plane for longer wavelength red light suf-
ficiently far forward to leave the tips of the outer segments unstimulated.
Lenses of sufficient strength to shift focus far enough forwards would
cause significant blurring of vision and would not be tolerated for contin-
uous wear. The use of progressive addition lenses has been claimed to slow
myopia progression in some children,
81
but in uncontrolled trials in
Australia and Singapore, the wearing of plus lenses of +3.00 D for a short
period during the day instead of their usual correction for myopia, failed
to slow the progression of myopia in most myopic children treated. A
379 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 379
study
82
in which one eye of myopic children was corrected for distance and
the other uncorrected or under-corrected to keep a refractive imbalance
between eyes of 2.00D showed that for reading, children accommodated
with the distance corrected eye and the under-corrected eye accommo-
dated to the same extent. The under-corrected eye suffered myopic defo-
cus from the combined effects of an under-corrected refractive error and
the imposed accommodation to match that of the fully corrected eye. This
myopic defocus of the under-corrected eye was shown to be sufficient to
slow the rate of myopia progression in the under-corrected eye. I.e. the
under-corrected eye benefitted from the equivalent of wearing a plus two
dioptre lens but only when a degree of accommodation was also present
sufficient to ensure significant myopic defocus. The myopic defocus would
result in divergence of light passing through the retina that among other
effects would be likely to alter the distribution of photon catch in the outer
segments in favour of an increased photon catch in the bases of the S-
cones.
Of all the factors inducing myopia that might be subject to manipula-
tion to reduce the progression of myopia or prevent its development, opti-
cal and chromatic factors would appear to offer some hope of therapeutic
application. In activities such as reading, measures to ensure that in addi-
tion to sharp focus of the reading material in the plane of interest there is
also a proportion of visual content from a further distance, if this could be
achieved, might be one approach.
As regards chromatic manipulation if the hypothesis we have advanced
can be supported by further work, modification of ambient lighting to
reduce its red content and increase the relative content of blue wavelengths
with the preservation of some mid-wavelength green would be worth
investigating as a therapeutic option.
As already indicated, current therapies for myopia are mainly aimed at
correcting the optical effects of myopia by correcting lenses or by refrac-
tive surgery. Although of benefit, they do not address the underlying
pathology of the condition that carries with it a number of potentially
sight-threatening complications.
The use of topically applied muscarinic receptor blocking agents such
as atropine is undoubtedly effective in preventing scleral elongation and so
reducing the progress of myopia. Atropine, however, carries the disadvan-
tage of paralyzing accommodation and dilating of the pupil, with result-
ant photophobia in bright light and an unknown and possibly adverse
effect on the retina from a long-term increase in light exposure.
380 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 380
Just as the etiology of myopia is likely to be multifactorial, so too, is it
likely that more than one therapeutic strategy may have to be employed in
the prevention of myopia or the slowing or arresting of its progression.
Thus a combination of optical and chromatic manipulation together with
pharmacological measures might offer a better cherapeutic option than
any individual intervention alone. A better understanding of the relative
importance of the various factors that appear to be involved in the etiol-
ogy of myopia and its progression would allow a more targeted therapeu-
tic approach to be developed and deployed.
References
1. Raviola E, Wiesel N. (1990) Neural control of eye growth and experimental
myopia in primates. In: Myopia and the Control of Eye Growth, pp. 23, CIBA
Foundation Symposium 155, John Wiley and Sons, Chichester.
2. Saw SM. (2003) A synopsis of the prevalence rates and environmental risk
factors for myopia. Clin Exp Optom 86: 289–294.
3. Saw SM, Gazzard G, Au-Eong KG, Tan DT. (2002) Myopia: attempts to arrest
progression. Br J Ophthalmol 86: 1306–1311.
4. Hodos W, Revzin AM, Kuenzel WJ. (1987) Thermal gradients in the chick eye:
A contributing factor in experimental myopia. Invest Ophthalmol Vis Sci 28:
1859–1866.
5. Hornbeal DM, Young TL. (2009) Myopia genetics: a review of current
research and emerging trends. Curr Opin Ophalmol 20: 356–362.
6. Wallmann J. (1990) Introduction. In: Myopia and the Control of Eye Growth,
pp 1, 3, CIBA Foundation Symposium 155, John Wiley and Sons, Chichester.
7. Raviola E, Wiesel N. (1990) Neural control of eye growth and experimental
myopia in primates. In: Myopia and the Control of Eye Growth, pp. 30–31,
CIBA Foundation Symposium 155, John Wiley and Sons, Chichester.
8. Troilo D. (1990) Experimental studies of emmetropization in the chick.
In: Myopia and the Control of Eye Growth, p. 95, CIBA Foundation Symposium
155, John Wiley and Sons, Chichester.
9. Irving EL, Callender MG,Sivak JG. (1991) Inducing myopia, hyperopia and
astigmatism in chicks. Optom Vis Sci 68: 344–368.
10. Saw SM, Shih-Yen EC, Koh A, Tan D. (2002) Interventions to retard myopia
progression in children: An evidence based update. Ophthalmology 109:
415–421.
11. Kennedy RH, Dyer JA, Kennedy MA, et al. (2000) Reducing the progression
of myopia with atropine: a long term cohort study of Olmsted County
Students. Binocul Vis Strabismus O 15(3): 381–384.
381 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 381
12. Fan DS, Lam DS, Chan CK, Fan AH, et al. (2007) Topical atropine in retard-
ing myopia progression and axial length growth in children with moderate to
severe myopia: a pilot study. Jpn J Ophthalmol 51: 27–33.
13. Chua WH, Balakrishnan V, Chan YH, et al. (2008) Atropine for the treatment
of childhood myopia. Ophthalmology 115: 1103–1104.
14. Lee JJ, Fang PC, Yang IH, et al. (2006) Prevention of myopia progression with
0.05% atropine solution. J Ocul Pharmacol Ther 22: 41–46.
15. Hutchins JB. (1987) Review: Acetylcholine as a neurotransmitter in the verte-
brate retina. Exp Eye Res 45: 1–38.
16. Barathi VA, Weon SR, Beuerman RW. (2009) Expression of muscarinic recep-
tors in human and mouse sclera and their role in the regulation of sclera
fibroblasts proliferation. Mol Vis 15: 1277–1293.
17. Cha LY, Weon SR, Beuerman RW. (2002) Effect of muscarinic agents and the
role of sclera fibroblasts in experimental myopia. Invest Ophthalmol Vis Sci 43:
E-Abstract 2411 ARVO.
18. McBrien NA, Moghaddam HO, Reeder AP. (1993) Atropine reduces experi-
mental myopia and eye enlargement via a nonaccommodative mechanism.
Invest Ophthalmol Vis Sci 34: 205–215.
19. Fischer AJ, McKinnon LA, Nathanson NM, Stell WK. (1998) Identification
and localization of muscarinic acetylcholine receptors in the ocular tissues of
the chick. J Comp Neurol 392: 273–284.
20. Yin GC, Gentle A, McBrien NA. (2004) Muscarinic antagonist control of
myopia: A molecular search for the M1 receptor in chick. Mol Vis 10: 787–793.
21. Lin HJ, Wan L, Tsai Y, Chen WC, et al. (2009) Muscarinic acetylcholine recep-
tor 1 gene polymorphisms associated with high myopia. Mol Vis 15:
1774–1780.
22. McBrien NA, Jobling AI, Truong HT, et al. (2009) Expression of muscarinic
receptor subtypes in tree shrew ocular tissues and their regulation during the
development of myopia. Mol Vis 15: 464–475.
23. Saw SM, D Hong CY, Chia KS, et al. (2001) Nearwork and myopia in young
children Lancet 357 (9253): 390.
24. Ip JM, Saw SM, Rose KA, et al. (2008) Role of near work in myopia: findings
in a sample of Australian school children. Invest Ophthalmol Vis Sci 49:
2903–2910.
25. Saw SM, Nieto FJ, Katz J, et al. (2000) Factors related to the progression of
myopia in Singaporean children. Optom Vis Sci 77: 549–554.
26. Mutti DO, Mitchell DL, Moeschberger ML, et al. (2002) Parental myopia, near
work, school achievement, and children’s refractive error. Invest Ophthalmol
Vis Sci 42: 3633–3640.
27. Jones LA, Sinott LT, Mutti DO, et al. (2007) Parental history of myopia, sports
and outdoor activities and future myopia. Invest Ophthalmol Vis Sci 48:
3524–3532.
382 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 382
28. Rose KA, Morgan IG, Ip J, Kifley A, et al. (2008) Outdoor activity reduces the
prevalence of myopia in children. Ophthalmology 115: 1279–1285.
29. Lu B, Congdon N, Liu X, et al. (2009) Associations between near work, out-
door activity, and myopia among adolescent students in rural China: the
Xichan Pediatric Refractive Error Study Report No 2. Arch Ophthalmol 127:
769–775.
30. Dirani M, Tong L, Gazzard G, et al. (2009) Outdoor activity and myopia in
Singapore teenage children. Br J Ophthalmol 93: 997–1000.
31. Schaefel F, Glasser A, Howland HC. (1988) Accommodation, refractive error
and eye growth in chickens. Vision Res. 28: 639–657.
32. Hung LF, Crawford ML, Smith EL. (1995) Spectacle lenses alter eye growth
and the refractive status of young monkeys. Nat Med 1: 761–765.
33. Troilo D, Wallman J. (1991) The regulation of eye growth and refractive state:
an experimental study of emmetropization. Vision Res 31: 1237–1250.
34. Wildsoet CF, Schmid KL. (2001) Emmetropization in chicks uses optical ver-
gence and relative distance cues to decode defocus. Vision Res 41: 197–204.
35. Seidemann A, Schaeffel F. (2002) Effects of longitudinal chromatic aberration
on accommodation and emmetropization. Vision Res 42: 2409–2417.
36. Rucker FJ, Kruger PB. (2006) Cone contributions to signals for accommoda-
tion and the relationship to refractive error. Vision Res 46: 3079–3089.
37. Rucker FJ, Wallman J. (2008) Cone signals for spectacle-lens compensation:
differential responses to short and long wavelengths. Visioin Res 48:
1980–1991.
38. Rucker FJ, Wallman J. (2009) Chick eyes compensate for chromatic stimula-
tion of hyperopic and myopic defocus: evidence that the eye uses longitudi-
nal chromatic aberration to guide eye growth. Vision Res 49: 1775–1783.
39. Hung GK, Ciuffreda KJ. (2007) Incremental retinal-defocus theory of myopia
development — schematic analysis and computer simulation. Comput Biol
Med 37: 930–946.
40. Schmid KL, Strang NC, Wildsoet CF. (1999) Imposed retinal image size
changes —do they provide a cue to the sign of lens-induced defocus in chick?
Optom Vis Sci 76: 320–325.
41. Lauber JK, Schutze JV, McGinnis J. (1961) Effects of exposure to continuous
light on the eye of the growing chick. Proc Soc Exp Biol Med 106: 871–872.
42. Li T, Troilo D, Glasser A, Howland HC. (1995) Constant light produces severe
corneal flattening and hyperopia in chickens. Vision Res 35: 1203–1209.
43. Bartmann M, Schaeffel F, Hagel G, Zrenner E. (1994) Constant light affects
retinal dopamine levels and blocks deprivation myopia but not lens-induced
refractive errors in chickens. Vis Neurosci 11: 199–208.
44. Cohen Y, Belkin M, Yehezkel O, et al. (2008) Light intensity modulates corneal
power and refraction in the chick eye exposed to continuous light. Vision Res
48: 2329–2335.
383 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 383
45. Lauber JK, Kinnear A. (1979) Eye enlargement in birds induced by dim light.
Can J Ophthalmol 14: 265–269.
46. Judge SJ. (1990) Discussion. In: Myopia and the Control of Eye Growth, pp. 17,
CIBA Foundation Symposium 155, John Wiley and Sons, Chichester.
47. Jacobs DS, Blakemore C. (1988) Factors limiting the postnatal development
of visual acuity in the monkey. Vision Res 28: 947–958.
48. Tran N, Chiu S, Tian Y, Wildsoet CF. (2008) The significance of retinal image
contrast and spatial frequency composition for eye growth modulation in
chicks. Vision Res 46: 1655–1662.
49. Schmid KL, Wildsoet CF. (1997) Contrast and spatial frequency requirements
for emmetropization in chicks. Vision Res 37: 2011–1021.
50. Diether S, Wildsoet CF. (2005) Stimulus requirements for the decoding of
myopic and hyperopic defocus under single and competing defocus condi-
tions in the chicken. Invest Ophthalmol Vis Sci 46: 2242–2252.
51. Hess RF, Schmid KL, Dumoulin SO, et al. (2006) What image properties
regulate eye growth? Curr Biol 16: 687–691.
52. Feldkaemper M, Diether S, Kleine G, Schaeffel F. (1999) Interactions of spa-
tial and luminance information in the retina of chickens during myopia
development. Exp Eye Res 68: 105–115.
53. Diether S, Gekeler F, Schaeffel F. (2001) Changes in contrast sensitivity
induced by defocus and their possible relations to emmetropization in the
chicken. Invest Ophthalmol Vis Sci 42: 3072–3079.
54. Crewther SG, Barutchu A, Murphy MJ, Crewther DP. (2006) Low frequency
temporal modulation of light promotes s myopic shift in refractive compen-
sation to all spectacle lenses. Exp Eye Res 83: 322–328.
55. Polak K, Schmetterer L, Riva CE. (2002) Influence of flicker frequency on
flicker-induced changes of retinal vessel diameter. Invest Ophthalmol Vis Sci
43: 2721–2726.
56. Kondo M, Wang L, Bill A. (1997) The role of nitric oxide in hyperaemic
response to to flicker in the retina and optic nerve in cats. Acta Ophthalmol
Scand 75: 232–235.
57. Luft WA, Iuvone PM, Stell WK. (2004) Spatial, temporal and intensive deter-
minants of dopamine release in the chick retina. Vis Neurosci 31: 627–635.
58. Crewther DP, Crewther SG. (2002) Refractive compensation to optical defo-
cus depends on the temporal profile of luminance modulation of the envi-
ronment. Neuroreport 13: 1029–1032.
59. McBrien NA, Adams DW. (1997) A longitudinal investigation of adult onset
and adult-progression of myopia in an occupational group: refractive and
biometric findings. Invest Ophthalmol Vis Sci 38: 321–333.
60. Nevin ST, Schmid KL, Wildsoet CF. (1998) Sharp vision: a prerequisite for
compensation to myopic defocus in the chick. Curr Eye Res 17: 322–331.
384 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 384
61. Stiles WS, Crawford BH. (1933) The luminous efficiency of rays entering the
eye pupil at different points. Proc R Soc 112: 428–450.
62. Lamb TD, McNaughton PA, Yau K-W. (1981) Spatial; spread of activation
and background desensitization in toad outer segments. J Physiol 319:
463–496.
63. Kay CD, Morrison JD. (XXXX) The effects of pupil size and defocus on
contrast sensitivity in man. J Physiol.
64. Liang H, Crewther DP, Crewther SG, Barila AM. (1965) A role for photore-
ceptor outer segments in the induction of deprivation myopia. Vision Res 35:
1217–1225.
65. Zhu X, Park TW, Winawer J, Wallman J. (2005) In a matter of minutes the eye
can know which way to grow. Invest Ophthalmol Vis Sci 46: 223–2241.
66. Mandelmann T, Sivak JG. (1983) Longitudinal chromatic aberration and the
vertebrate eye. Vision Res 23: 1555–1559.
67. López-López R, López-Galllardo M, Pérez-Alvarez MJ, Prada C. (2008)
Isolation of chick retina cones and study of their diversity based on oil droplet
colour and nucleus position. Cell Tissue Res 332: 13–24.
68. Rohrer B, Schaeffel F, Zrenner E. (1992) Longitudinal chromatic aberration
and emmetropization: results from the chicken eye. J Physiol 449: 363–376.
69. Kroger RH, Binder S. (2000) Use of paper selectively absorbing long wave-
lengths to reduce the impact of educational near work on human refractive
development. Br J Ophthalmol 84: 890–893.
70. Stone D, Mathews S, Kruger PB. (1993) Accommodation and chromatic
aberration: effect of spatial frequency. Ophthalmic Physiol Opt 13: 244–252.
71. Wagner Hg, Kroger RH. (2005) Adaptive plasticity during the development of
colour vision. Prog Retin Eye Res 24: 521–536.
72. Kröger RHH, Wagner H-J. (1996) The eye of the blue acara (Aequidens
pulcher, Cichlidae) grows to compensate for defocus due to chromatic
aberration. J Comp Physiol A 179: 837–842.
73. Marmor MF, Jacobson SG, Foester MH, et al. (1990) Diagnostic clinical find-
ings of a new syndrome with night blindness, maculopathy and enhanced
S cone sensitivity. Am J Ophthalmol 110: 124–134.
74. Hood DC, Cideciyan AV, Roman AJ, Jacobson SG. (1995) Enhanced S cone
syndrome: evidence for an abnormally large number of S cones. Vision Res 35:
1473–1481.
75. Kim HH, Goins GD, Wheeler RM, Sager JC. (2004) Green-light supplemen-
tation for enhanced lettuce growth under red- and blue-light-emitting
diodes. HortScience 39: 1617–1622.
76. Czepita D, Goslawski W, Mojsa A. (2004) Refractive errors among students
occupying rooms lighted with incandescent or fluorescent lamps. Ann Acad
Med Stetin 50: 51–54.
385 Physical Factors in Myopia and Potential Therapies
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 385
77. Mandel Y, Grotto I, El-Yanif R, et al. (2008) Season of birth, natural light and
myopia. Ophthalmology 115: 686–692.
78. McMahon G, Zayats T, Chen YP, et al. Season of birth, daylight hours at birth
and high myopia. Ophthalmology 116: 468–473.
79. Mehdizadeh M, Nowroozzedah MH. (2009). Outdoor activity and myopia.
Letter to the Editor. Ophthalmology 116: 1229–1230.
80. Qian Y-S, Yuan R-Y, He JC, et al. (2009) Incidence of myopia in high school
students with and without red-green color deficiency. Invest Ophthalmol Vis
Sci 50: 1598–1605.
81. Gwiazda J. (2008) Progressive addition lenses slow myopic progression in
some children: Insights from COMET. Abs Myopia: Proceedings of the 12th
International Conference. Optom Vis Sci 86: E67–E73.
82. Phillips JR. (2005) Monovision slows juvenile myopia progression unilaterally.
Brit J Ophthalmol 89: 1196–1200.
386 W.S. Foulds and C.D. Luu
b846_Chapter-5.2.qxd 4/8/2010 2:04 AM Page 386
additive genetic effects 189–191
angle closure 124
anterior chamber depth 183, 185,
188, 190–192
association 202–209
atropine 345, 346, 348–356
Australian Twin Registry (ATR)
195, 196
axial length 24, 26, 28, 30, 33, 35,
37, 39, 122, 124, 126, 128–130,
183, 185, 188, 190–192, 196
Beaver Dam Eye Study (BDES)
7–10, 14, 34
biomechanics 292
bipolar 149, 150, 152, 156
birth head circumference 34
birth length 34, 36
birth parameters 24, 34–36
birth weight 34, 36, 38, 40, 183, 194
BMI 32–34, 38
body mass index 194
breastfeeding 24, 38–40
Brisbane Adolescent Twin Study
196
Burden of disease 63, 66, 72, 75
candidate genes 203
case-control association study 219
cataract 99–106, 110, 112
central corneal thickness 125, 126
children 23–25, 27, 29, 31, 32, 34,
36, 38–40
choroids 254, 255
chromatic aberration 245, 246, 365,
366, 371–373
chromaticity 371, 373–375,
377–379
classical twin model 185–188, 190,
192, 193, 196
clinical trials 356
close reading 27, 40
close-up work 29
Cochran-Armitage trend test 224
collagen 270–274, 277, 279–283,
286, 288, 290, 292, 298
contrast sensitivity 319, 321
corneal curvature 124, 126, 183,
185, 190, 191
correlated phenotypes 225
cost 63–66, 72–75
cross-sectional 24–33, 35–39
cycloplegia 354
Danish Twin Registry (DTR) 195,
196
definitions of myopia 24
diopter-hours 29
dizygotic twins (DZ) 185–188, 193,
194
DNA array 336
dominant genetic effects 191
387
Index
b846_Index.qxd 4/13/2010 3:33 PM Page 387
Economics 63
Eigenstrat 219, 222
electroretinography 149–152, 156
emmetropization 244, 246, 248,
249, 258
environment 45–50, 53, 54, 56, 57
environmental 23, 29, 40
epidemiologic studies 24
epidemiology 3, 4, 16, 99
equal environment assumption (EEA)
193
ERG 150–153, 155, 156
etiology 361–363, 367, 372, 381
family history 24–26, 40
family-based association study 215,
219, 224
fibroblast 268, 271, 272, 289, 291, 292
Fisher’s method 228
Fisher-exact test 224
fovea 247–249, 258
gene-environment interactions
45–47, 53, 56, 57
generalized estimate equation (GEE)
226, 227
genes 46–49, 51, 54, 331–335, 338,
340
Genes in Myopia (GEM) Study 196
Genes in Myopia (GEM) twin study
36
genetic epidemiology 204
Genome-wide Association Studies
(GWAS) 164, 168–172, 176,
177, 215, 216, 219, 221, 223, 227,
229, 230
genomic control 219, 221, 222
genomic convergence 168–170, 177
genotype 45–47, 51
gestational age 34, 36
glaucoma 100, 101, 106–109, 112
glucagon 251, 252
glycosaminoglycans 272, 274, 282,
283
Handan Eye Study 37
Hardy-Weinberg Equilibrium (HWE)
221
height 25, 31, 32–34, 38, 40, 185,
188, 194
heritability 48–51, 188–193, 195,
196
high myopia 47, 48, 51, 52, 55–57,
216–218
human genome 332
imputation 227
insulin 251, 252
intensity 365, 366, 378
item response theory 91
keratometry 307, 314
lacquer crack 137, 139, 140
linear model 224, 226
logistic regression 224
longitudinal study 25, 26, 29, 30
low coherence interferometry 306,
316
Meiktila Eye Survey (MES) 34
meta-analysis 227, 228
minor allele frequency (MAF) 221
monozygotic twins (MZ) 185–188,
193, 194
mouse 303–305, 308–325, 332–338,
340
multifocal ERG 151, 153
multi-locus analysis 171, 172, 174,
176
muscarinic receptors 347, 355
mutants 303
388 Index
b846_Index.qxd 4/13/2010 3:33 PM Page 388
myofibroblast 272, 289–291, 293
myopia 3–16, 23–40, 45–57, 83–92,
97–113, 183–197, 201–210,
215–219, 225, 230, 267–269,
273–290, 292–298, 303, 304,
309–311, 315, 322–326, 331–338,
340, 361–373, 375–381
myopia loci 169
myopia progression 149, 154
myopic choroidal neovascularization
140
myopic macular degeneration 137
myopic maculopathy 110
myopic retinopathy 99, 110, 111
near work 23, 24, 27–29, 31, 32, 38,
40, 53, 55, 56
ocular biometry 23, 24, 26, 28, 30,
33–35, 37, 39, 40
optic disc 125, 127–129
optic nerve head 127–129
optical factors 367
optomotor response 319, 321, 323
Orinda Longitudinal Study of Myopia
(OLSM) 25, 29
oscillatory potentials 150, 153
outdoor 23, 24, 27, 29–32, 38, 40, 45,
53, 55, 56
pathology 99, 110, 112, 113
pathway analysis 168, 169, 171, 172,
176, 177
patient-reported outcome measures
84
periodicity 365, 366, 378
personality traits 194, 195
pharmacogenetics 353
pharmacology 355
phenotype 46, 49–51, 53
photon catch 369–375, 377–380
photoreceptor 149, 150, 152, 155,
156
photorefraction 307, 309
physical activity 31
pigment dispersion 124
pirenzepine 346, 348, 350, 355
population structure 219, 221
population-based 24, 26–28, 30,
32–35, 37–39
prevalence 3, 4, 6–9, 11–13, 66–70,
72, 76
primary open angle glaucoma 121
principle component analysis (PCA)
221, 222
public health 201
quality controls (QC) 220, 221
Quantitative Trait Loci (QTL) 215
reading 27, 29, 31, 32, 38, 40
refraction 184, 186–193
refractive error 24, 25, 29, 30, 38,
39
retinal detachment 137, 144–147
retinal function 149, 150, 152–154,
156
retinal nerve fibre layer 128
retinoic acid 252–255
Reykjavik Eye Study (RES) 34
risk factors 3, 4, 10, 23–26, 28, 33,
35, 37, 39, 40
school myopia 45, 51–53, 57
school-based 25–32
sclera 250–252, 254–257, 267–277,
279–286, 288–290, 292–296, 298,
334–337, 339
Singapore Cohort Study of the Risk
factors for Myopia (SCORM)
25, 27, 31, 32, 34, 36, 38, 216, 222,
223, 225, 226, 229, 230
389 Index
b846_Index.qxd 4/13/2010 3:33 PM Page 389
Singapore Malay Eye Study (SiMES)
34
single nucleotide polymorphisms
(SNPs) 220–222, 224, 227–229
smoking 24, 36–38, 40
spatial frequency 366, 367, 373, 378
sphere (SPH) 217, 218, 225
spherical equivalent (SE) 24, 26, 28,
30, 33, 35, 37, 39, 217, 218
sports 29, 31
St Thomas’ UK Adult Twin Registry
195, 196
staphyloma 267, 273, 277, 279, 280
stature 32, 33
Strabismus, Amblyopia and Refractive
Error Study (STARS) 38
structure 219, 221, 222, 229
Sydney Myopia Study (SMS) 24, 25,
27, 31, 32, 34
Tanjong Pagar Survey (TPS) 32,
33
therapy 362
twin registries 195, 196
Twins Eye Study in Tasmania 196
vergence 361, 365, 369–371,
377–379
vision-specific functioning and
quality of life 83
visual acuity 304, 305, 309, 318,
319, 321
visual field 125, 128, 130
visual optics 304
weight 32–34, 36, 38, 40, 183, 194
Xichang Pediatric Refractive Error
Study (X-PRES) 29, 31
390 Index
b846_Index.qxd 4/13/2010 3:33 PM Page 390
The Singapore Eye Research Institute (SERI)
is the national research institute for ophthalmol-
ogy and vision research in Singapore, and is affili-
ated with the National University of Singapore
(NUS). SERI is the focal point of eye research in
Singapore, serving as the research arm of the
Singapore National Eye Centre (SNEC) and other
eye departments, including the National University
Health Systems (NUHS), and Tan Tock Seng
Hospital. It has close working relationships with
the A*STAR Research Institutes, Duke-NUS
Graduate Medical School, the Nanyang
Technological University and other biomedical
institutions and eye centers in Singapore and
throughout the world. Founded in 1997, SERI has
developed a reputation over the last 13 years, as a
leading research center in Asia, conducting
broad-based basic, clinical, epidemiology and
translational research programmes for various
eye diseases, particularly diseases relevant to Asia.
11 Third Hospital Avenue, Singapore 168751
Tel: (65) 63224500 • Fax: (65) 63231903
UEN NO: 199704888Z • Charity No: 01638
www.seri.com.sg
A subsidiary of the Singapore National Eye Centre
b846_SERI.qxd 4/8/2010 2:05 AM Page 393

Sponsor Documents

Or use your account on DocShare.tips

Hide

Forgot your password?

Or register your new account on DocShare.tips

Hide

Lost your password? Please enter your email address. You will receive a link to create a new password.

Back to log-in

Close