OPTOMETRY ADMISSION TEST PRACTICE BIOLOGY QUESTIONS
1
www.ioatprep.com
1. Plant cells contain all of the following, EXCEPT: A. Cell Wall B. Vacuoles C. Centrioles D. Plastids
2. Prokaryotes’ and Eukaryotes’ main difference lies in this structure of the cell: A. Cell Wall B. Nucleus C. Cytoplasm D. Mitochondria
3. Which of the following is TRUE of the features of an active site of an enzyme? A. This site takes up more than half of the total volume of all enzymes. B. Several strong attractions bind the substrate to the enzyme. C. This site is a crevice in the enzyme. D. Overall specificity of its binding process depends on the cofactors and substrates.
For questions 4 and 5, please look at the following illustration. (This graph shows the effect of inhibition to normal enzymatic reaction)
A B
4. Line A represents this type of inhibition. A. Competitive B. Non-‐Competitive C. Uncompetitive D. Irreversible
5. Line B represents a type of inhibition having these characteristics: A. Same Km, Different Vmax B. Same Km, Same Vmax C. Different Km, Same Vmax D. Different Km, Different Vmax
6. How many checkpoints are there in a cell cycle? A. 1 B. 2 C. 3
2
D. 4
www.ioatprep.com
7. Homologue pairings and crossing over occurs in: A. Mitosis B. Meiosis C. Both D. None of the Above
8. The following are TRUE of cellular respiration, EXCEPT: A. Glycolysis is a process of producing ATP from glucose via substrate-‐level phosphorylation. B. Oxygen is an excellent electron acceptor to recycle NADH into NAD+. C. In the electron transport chain, 3 ATP’s can be produced from NADH while only 2 ATP’s can be activated from FAD2. D. 2 oxidations occur in the Kreb’s cycle, oxidation of α-‐ketoglutarate and succinate.
9. The actual yield of ATP in respiration is lower than the theoretical yield because: A. The inner mitochondrial membranes are leaky to proteins. B. Chemiosmotic-‐generated proton gradient is not solely used for ATP synthesis. C. Both of the Above D. None of the Above
10. Cactus is a succulent desert plant that uses this type of photosynthesis. A. C3 B. C4 C. CAM D. Only B & C
11. All of the statements are TRUE, EXCEPT. A. There are more cavities in the coelom of the Reptiles than Amphibians. B. Diaphragm separates the peritoneal cavity from the thoracic cavity. C. Thoracic cavity can be divided into peritoneal cavity and pleural cavity. D. None of the Above.
12. The largest organ of the body is the: A. Liver B. Brain C. Skin D. Heart
13. The following are TRUE about endoskeleton, EXCEPT: A. Composed of rigid internal bones and cartilages. B. Moves the body by contraction of muscles attached to the skeleton. C. Limits the size of an individual. D. Capable of remodeling.
3
www.ioatprep.com
For questions 14 and 15, please look at the following illustration. (This is an electron microscopic view of a sarcomere)
14. The white arrows represent what part of the sarcomere? A. M-‐line B. Z-‐disk C. H-‐band D. I-‐band
15. The black arrows point to heavily shaded lines representing what kind of fibers? A. Thin Fibers B. Thick Fibers C. Both D. None of the Above
16. In humans, there are three pairs of salivary glands that secrete saliva through ducts in the mouth’s mucosal lining. These are: A. Submandibular, Sublingual and Parotid
B. Submandibular, Submaxillary and Parotid C. Submandibular, Submaxillary and Sublingual D. Submaxillary, Sublingual and Parotid
17. The following associations between immunologic cell types and their functions are TRUE, EXCEPT: A. Helper T-‐cells detects infection, initiating both T cell and B cell responses. B. Plasma cells produce antibodies directed against specific foreign antigens. C. Cytotoxic T-‐cells detects and kills infected body cells. D. Inducer T-‐cells induce an inflammatory response, aiding the arrival of leukocytes at the site of infection.
18. Which of the following are stored in the Neurohypophysis? A. Vasopressin and Oxytocin B. Prolactin and Oxytocin C. Vasopressin and Prolactin D. None of the Above
19.
Which of the following is TRUE about the Nervous System: A. Schwann cells produce myelin in the CNS.
4
www.ioatprep.com
B. Transmission through an unmyelinated sheath is enhanced by “Saltatory Conduction”. C. Dendrites covered in myelin sheaths are said to be myelinated. D. The simplest nervous systems occur among cnidarians.
20. These mechanoreceptors are all intermittently activated (phasic), EXCEPT: A. Hair follicle receptors B. Meissner’s corpuscles C. Pacinian corpuscles D. Merkel cells
For question 21. Refer to the illustration below. (This is a graphical representation of Adenine)
21. What type of nitrogen-‐containing base is the structure given above? A. Purine B. Pyrimidine C. Both D. None of the Above
22. During transcription, the gene must be spliced to remove non-‐coding regions. The sequence that will be spliced out is:
A. Exons B. Introns C. Cistrons D. None of the Above
23. What kind of mutation can be seen in the following example?
Normal sequence : ACTGGGTACGCCAAGTGTACG
Mutated sequence : ACTGGGTACACCAAGTGTACG A. Germ-‐line mutation B. Somatic tissue mutation C. Point mutation D. Spontaneous mutation
5
www.ioatprep.com
For questions 24 and 25. Refer to the illustration below. (This is a Punnet Square showing a monohybrid cross)
A
24. What is the genotype of seed A? A. AA B. Aa C. aa D. None of the Above
25. If there will be a cross between seed A and seed B, what is the genotypic ratio? E. 1:2:1 F. 2:1:1 G. 1:1:2 H. 3:1
26. A case was presented where a couple with blood types A and B for mother and father respectively, had a child having a blood type of O. Is this possible?
A. Yes B. No C. Lack of information D. None of the Above
For question 27. Refer to the illustration below.
B
27. This pedigree analysis shows what mode of inheritance? A. Sex-‐linked Dominant B. Sex-‐linked Recessive C. Autosomal Dominant D. Autosomal Recessive
6
www.ioatprep.com
28. Trisomy 13 is what genetic disorder?
A. Down syndrome B. Patau syndrome C. Edwards syndrome D. None of the above
29. A genetic disorder involving a nondisjunction of the sex chromosomes where an XX gamete combines with a Y gamete resulting to an XXY zygote and developing into a sterile male who has many female body characteristics and, in some cases, mental retardation: A. Turner Syndrome B. Klinefelter Syndrome C. Jacob’s Syndrome D. Triple X Syndrome
30. True of Polymerase Chain Reaction (PCR): A. Annealing is needed to dissociate the double helix DNA into single strands. B. Primer extension may be done at a temperature of about 50 -‐ 65°C. C. Denaturation is an optional step in PCR but may be done to optimize the reaction. D. An agarose gel electrophoresis is done after PCR to view the DNA bands.
31. If fertilization does not occur, corpus luteum develops. After it has reached its maximum development, these next series of events occur, EXCEPT: A. Degeneration of lutean cells causing the corpus luteum to shrink.
B. Corpus albicans now forms as a mass of fibrotic tissue. C. Progesterone production now increases. D. Menstrual bleeding ensues.
32. Identify the decidua component that is found on top of the chorion frondosum: A. Decidua Capsularis
B. Decidua Basalis C. Decidua Parietalis D. Decidua Marginalis
33. All of these contribute to the development of the body’s skeletal system, EXCEPT: A. Paraxial Mesoderm B. Somatic Mesoderm C. Splanchnic Mesoderm D. Neural Crest
34. In the cloacal membrane, mesenchymal cells migrate to form cloacal folds, cranial to this is the genital tubercle while caudal to this is the urethral fold which in males swells and becomes the: A. Penis
B. Scrotum C. Testes D. Prostate Gland
7
www.ioatprep.com
35. In taxonomy, the correct hierarchy of classification of all living things is: A. Kingdom-‐Phylum-‐Class-‐Family-‐Order-‐Genus-‐Species B. Kingdom-‐Phylum-‐Family-‐Class-‐Order-‐Genus-‐Species C. Kingdom-‐Phylum-‐Order-‐Class-‐Family-‐Genus-‐Species D. Kingdom-‐Phylum-‐Class-‐Order-‐Family-‐Genus-‐Species
36. The following are all phyla from the Kingdom Fungi, EXCEPT: A. Ascomycota B. Acrasiomycota C. Basidiomycota D. Zygomycota
37. In terms of body cavity, which of the following is different? A. Phylum Platyhelminthes B. Phylum Molusca C. Phylum Annelida D. Phylum Arthropoda
38. According to the Hardy–Weinberg principle, both the allele and genotype frequencies in a large, random-‐mating population will remain constant from generation to generation if none of these processes would occur: A. Selection B. Mutation C. Gene Flow D. All of the Above
39. Cladistics is: A. A biological approach that reconstructs and studies all phylogenies. B. A biological approach that constructs differences and similarities between organisms into an evolutionary tree.
C. A biological approach that infers phylogeny according to similarities derived from a common ancestor. D. All of the Above
40. True of community ecology: A. Niche is synonymous with habitat. B. Habitat is a pattern of living. C. Interspecific competition may occur within their niche. D. Habitat is described in terms of space utilization, food consumption and temperature range to name a few.
8
Answer Key:
1. C 2. B 3. C 4. A 5. A 6. C
7. B 8. D 9. C 10. C 11. C 12. C 13. C
14. B
15. C 16. A
17. D 18. A 19. D 20. D 21. A
22. B
www.ioatprep.com
9
23. C 24. B
25. A 26. A 27. C
28. B 29. B 30. D 31. C 32. A 32. C 34. B 35. D 36. B 37. A 38. D 39. C 40. C